User: saadleeshehreen

Reputation:
40
Status:
New User
Location:
Last seen:
10 hours ago
Joined:
5 months, 1 week ago
Email:
s**************@gmail.com

Posts by saadleeshehreen

<prev • 37 results • page 1 of 4 • next >
2
votes
1
answer
139
views
1
answer
writing function for logistic regression
... Hi, My .csv files contain 2021 rows with 25 columns. All of the columns have "0" or "1" on the basis of absence and presence. I want to see the correlation among column CAS_COUNT(24), ACR_COUNT(25) and Antibiotic(8-23). Logistic regression analysis might be the best way to describe the association ...
R statistic written 13 hours ago by saadleeshehreen40 • updated 5 hours ago by zx87544.8k
0
votes
1
answer
78
views
1
answers
Comment: C: Removing duplicate protein sequences from fasta file
... Thanks a lot! It works. ...
written 5 days ago by saadleeshehreen40
2
votes
1
answer
78
views
1
answer
Removing duplicate protein sequences from fasta file
... Hi, I want to do psiblast in command line. Before, performing psiblast, I tried to make a blast database by using makeblastdb command. But it shows the following error: BLAST Database creation error: Error: Duplicate seq_ids are found: REF|WP_003261842.1 My fasta file is very large. So, man ...
makeblastdb database blast written 5 days ago by saadleeshehreen40 • updated 5 days ago by finswimmer4.5k
0
votes
0
answers
160
views
0
answers
Comment: C: Gubbins not working
... Trying to run gubbins after conversion. It behaves ok initially and generated some files. But, stopped and gave an error message " Failed while running gubbins. Please ensure you have enough free memory" It was running on the server and was just tried with 4 genomes. As while trying 2, it gave t ...
written 28 days ago by saadleeshehreen40
0
votes
0
answers
160
views
0
answers
Comment: C: Gubbins not working
... For my work, I need to align 100 whole genomes of different bacteria. But this time I just tested with two of them. I downloaded sequences from NCBI and aligned with progressiveMauve. Then, planning to run gubbins. ...
written 29 days ago by saadleeshehreen40
0
votes
0
answers
160
views
0
answers
Comment: C: Gubbins not working
... The full error message is following: -bash-4.2$ run_gubbins.py t.fasta Unexpected error: Error with the input FASTA file: It is in the wrong format so check its an alignment Each sequence must be the same length There is a problem with your input fasta file so nothing can be ...
written 29 days ago by saadleeshehreen40
0
votes
0
answers
160
views
0
answers
Comment: C: Gubbins not working
... >1 AACCGCGCCTACCGCATGGGCCGCGGGATCAAGGCCGGTCGCGTGTGGACCAACTGCTAC CACCTGTACCCGGCCCACGCCGCGTTCGGCGGCTACAAGAAATCCGGCGTCGGTCGCGAG But sometimes have NNNNNN ---------------- , etc ...
written 29 days ago by saadleeshehreen40
0
votes
0
answers
160
views
0
answers
Comment: C: Gubbins not working
... Please let me know the name of that tool, if u recall ..:) ...
written 29 days ago by saadleeshehreen40
0
votes
0
answers
160
views
0
answers
Gubbins not working
... Hi, I tried to run the following software. https://sanger-pathogens.github.io/gubbins/ Firstly, I aligned the files with progressiveMauve. It produced .xmfa files and I understood I had to convert the file in proper fasta. I then followed the instructions from https://sourceforge.net/p/mauve/mai ...
gubbin xmfa mauve written 29 days ago by saadleeshehreen40
0
votes
1
answer
113
views
1
answers
Comment: C: Downloading Genome Assembly and Annotation report from NCBI
... Thanks a lot...:) I am looking for this one ...
written 29 days ago by saadleeshehreen40

Latest awards to saadleeshehreen

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1606 users visited in the last hour