User: shuksi1984

gravatar for shuksi1984
shuksi198450
Reputation:
50
Status:
New User
Location:
Last seen:
1 month, 2 weeks ago
Joined:
1 year ago
Email:
s*********@gmail.com

Posts by shuksi1984

<prev • 102 results • page 1 of 11 • next >
0
votes
1
answer
122
views
1
answer
Metagenomics raw data to develop pipeline
... I want to build metagenomics pipeline. To start with, need raw data. How to identify and get raw data for bacterial taxaonomy, phylogenetic analysis, and resistance gene identification? I believe for taxonomic classification and phylogenetic analysis, the raw data will have reads from multiple bact ...
genome next-gen sequencing written 10 weeks ago by shuksi198450 • updated 10 weeks ago by 5heikki8.4k
1
vote
0
answers
261
views
0
answers
Comment: C: What do you want to learn about bioinformatics?
... Why should a person choose bioinformatics as a carrer? What is so exciting about the course? Why are we exploring genomics? How can a Bioinformatics scientist help us in day to day life? (Maybe we can elaborate bioinfo in healthcare) ...
written 3 months ago by shuksi198450
0
votes
0
answers
277
views
0
answers
Comment: C: chatbot for genomics
... How about using IBM assistant??? ...
written 3 months ago by shuksi198450
0
votes
0
answers
277
views
0
answers
Comment: C: chatbot for genomics
... Educate people about genomics. ...
written 3 months ago by shuksi198450
1
vote
0
answers
277
views
0
answers
chatbot for genomics
... How to get started to create a chatbot for genomics? Kindly, share the links or websites or idea to get started on it. I am NGS data analyst with the knowledge of bioinformatics, linux, and Python. Also, let me know the importance of machine learning in genomics. ...
genome written 3 months ago by shuksi198450
0
votes
7
answers
62k
views
7
answers
Comment: C: How To Get The Sequence Of A Genomic Region From Ucsc?
... I think, now UCSC browser has changed. Even I have the same query, but unable to fetch FASTA sequence using the coordinates. Can u explain using the given link.. https://genome.ucsc.edu/cgi-bin/hgTables?hgsid=703655381_NWHqxkgVDaPPscUhaKxyA9bAbb7e ...
written 4 months ago by shuksi198450
0
votes
0
answers
277
views
0
answers
Comment: C: Biopython for NGS
... While browsing, I also came across Ruffus. How about Ruffus? Which one would be better sankemake or Ruffus? Although, both are python library but there must be some difference ...
written 4 months ago by shuksi198450
4
votes
0
answers
277
views
0
answers
Biopython for NGS
... Can I use Biopython to automate the NGS pipeline. If yes, which Biopython library can be used to run GATK, SAMTOOLS, bwa, PICARD. ? I hope my question is clear. ...
next-gen snp sequencing written 4 months ago by shuksi198450
3
votes
0
answers
233
views
0
answers
Extract specific information from BLASTn output
... How can I extract query sequence, it's corresponding rsid, subject sequence, it's corresponding rsID, score, and blast metadata in excel sheet from BLASTn output? ...
genome alignment sequence written 5 months ago by shuksi198450
0
votes
0
answers
284
views
0
answers
Comment: C: standalone blast output to excel
... Following should be the content of excel: Score Expect Identities Gaps Strand 6.684e+06 bits(3619559) 0.0 3619559/3619559(100%) 0/3619559(0%) Plus/Plus Query 1 TACCATTTGAGTATTTCTGAATTTAGGTATTTATTTTCGCGTTCGTATAGAAATACTCCA 60 |||||||||||||||||||||||||||||||||||| ...
written 5 months ago by shuksi198450 • updated 5 months ago by finswimmer11k

Latest awards to shuksi1984

Centurion 3 months ago, created 100 posts.
Rising Star 10 months ago, created 50 posts within first three months of joining.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1508 users visited in the last hour