User: shuksi1984

gravatar for shuksi1984
shuksi198440
Reputation:
40
Status:
New User
Location:
Last seen:
2 weeks, 3 days ago
Joined:
9 months, 2 weeks ago
Email:
s*********@gmail.com

Posts by shuksi1984

<prev • 101 results • page 1 of 11 • next >
1
vote
0
answers
162
views
0
answers
Comment: C: What do you want to learn about bioinformatics?
... Why should a person choose bioinformatics as a carrer? What is so exciting about the course? Why are we exploring genomics? How can a Bioinformatics scientist help us in day to day life? (Maybe we can elaborate bioinfo in healthcare) ...
written 19 days ago by shuksi198440
0
votes
0
answers
206
views
0
answers
Comment: C: chatbot for genomics
... How about using IBM assistant??? ...
written 26 days ago by shuksi198440
0
votes
0
answers
206
views
0
answers
Comment: C: chatbot for genomics
... Educate people about genomics. ...
written 28 days ago by shuksi198440
1
vote
0
answers
206
views
0
answers
chatbot for genomics
... How to get started to create a chatbot for genomics? Kindly, share the links or websites or idea to get started on it. I am NGS data analyst with the knowledge of bioinformatics, linux, and Python. Also, let me know the importance of machine learning in genomics. ...
genome written 28 days ago by shuksi198440
0
votes
7
answers
59k
views
7
answers
Comment: C: How To Get The Sequence Of A Genomic Region From Ucsc?
... I think, now UCSC browser has changed. Even I have the same query, but unable to fetch FASTA sequence using the coordinates. Can u explain using the given link.. https://genome.ucsc.edu/cgi-bin/hgTables?hgsid=703655381_NWHqxkgVDaPPscUhaKxyA9bAbb7e ...
written 4 weeks ago by shuksi198440
0
votes
0
answers
202
views
0
answers
Comment: C: Biopython for NGS
... While browsing, I also came across Ruffus. How about Ruffus? Which one would be better sankemake or Ruffus? Although, both are python library but there must be some difference ...
written 8 weeks ago by shuksi198440
4
votes
0
answers
202
views
0
answers
Biopython for NGS
... Can I use Biopython to automate the NGS pipeline. If yes, which Biopython library can be used to run GATK, SAMTOOLS, bwa, PICARD. ? I hope my question is clear. ...
next-gen snp sequencing written 8 weeks ago by shuksi198440
3
votes
0
answers
160
views
0
answers
Extract specific information from BLASTn output
... How can I extract query sequence, it's corresponding rsid, subject sequence, it's corresponding rsID, score, and blast metadata in excel sheet from BLASTn output? ...
genome alignment sequence written 9 weeks ago by shuksi198440
0
votes
0
answers
193
views
0
answers
Comment: C: standalone blast output to excel
... Following should be the content of excel: Score Expect Identities Gaps Strand 6.684e+06 bits(3619559) 0.0 3619559/3619559(100%) 0/3619559(0%) Plus/Plus Query 1 TACCATTTGAGTATTTCTGAATTTAGGTATTTATTTTCGCGTTCGTATAGAAATACTCCA 60 |||||||||||||||||||||||||||||||||||| ...
written 3 months ago by shuksi198440 • updated 3 months ago by finswimmer9.0k
1
vote
0
answers
193
views
5 follow
0
answers
standalone blast output to excel
... I want the standalone blast output in a specific format, which needs to have only aligned sequence the corresponding sequence id . Hence, is it possible to dump standalone blast output to excel? ...
genome alignment sequence written 3 months ago by shuksi198440

Latest awards to shuksi1984

Centurion 19 days ago, created 100 posts.
Rising Star 7 months ago, created 50 posts within first three months of joining.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1346 users visited in the last hour