User: Arko

gravatar for Arko
Arko30
Reputation:
30
Status:
New User
Location:
US/Boston/Boston University
Last seen:
2 months ago
Joined:
1 year, 8 months ago
Email:
a*****@bu.edu

Posts by Arko

<prev • 25 results • page 1 of 3 • next >
0
votes
0
answers
136
views
0
answers
Does having sample identifiers in a Seurat object semi-supervise PCA results?
... I'm working with 4 samples (10x sequenced) and loading them into Seurat using the Read10x() function to read them in and then using the merge() function to combine them into 1 object. But on doing this, each sample is given a sample ID given to it based on the origin of the data. While running PCA ...
single-cell seurat3 pca analysis unsupervised written 9 weeks ago by Arko30
0
votes
0
answers
203
views
0
answers
Comment: C: Processing WES mouse data using GATK on Terra Bio
... I plan on doing that soon, thought I'd see if the community would have any suggestions first. Thanks! ...
written 4 months ago by Arko30
1
vote
0
answers
203
views
0
answers
Processing WES mouse data using GATK on Terra Bio
... I'm working with whole exome sequencing data from mouse (mm9) in the fastq format. I have an interval list for the sequencing data as well and I want to obtain VCF files from each sample, using GATK best practices on Terra Bio but GATK best practices are tailored to only to human data, so all the WD ...
terra gatk exome mm9 firecloud written 4 months ago by Arko30 • updated 16 days ago by ati_0
0
votes
0
answers
186
views
0
answers
Comment: C: How to obtain loading eigenvalues from CPCA?
... I was hoping it wouldn't come to that, altering source code always ends up breaking it. At least in my case. Thanks though! ...
written 5 months ago by Arko30
1
vote
0
answers
186
views
0
answers
How to obtain loading eigenvalues from CPCA?
... I'm experimenting with CPCA made available in the contrastive module in python. Description found here - https://www.nature.com/articles/s41467-018-04608-8#Bib1 GitHub and Description here - https://github.com/abidlabs/contrastive I'm trying to obtain the eigenvalues (loadings) for the CPCA run, ...
python contrastive cpca written 5 months ago by Arko30
0
votes
1
answer
300
views
1
answers
Comment: C: ValueError("End of file without quality information.") when using SeqIO
... Thanks for the tip! ...
written 6 months ago by Arko30
0
votes
1
answer
300
views
1
answers
Comment: C: ValueError("End of file without quality information.") when using SeqIO
... Good idea, I shall have a look at it! ...
written 6 months ago by Arko30
0
votes
1
answer
300
views
1
answers
Comment: C: ValueError("End of file without quality information.") when using SeqIO
... 6AAAAEEEEEEEEEEEEEEEE////A @NS500496_727_H373LBGXB:2:23203:12170:5855#AGAATAAAAGAGTGAT/1 GAGGAAGTTCCAGCCAAGGAGATTGA +NS500496_727_H373LBGXB:2:23203:12170:5855#AGAATAAAAGAGTGAT/1 AAAAAEEAEE/AEEAAEEAEE//E/< @NS500496_727_H373LBGXB:2:23203:1526:5855#ACATCATCCCGAGTGG/1 CAG ...
written 6 months ago by Arko30 • updated 6 months ago by RamRS25k
4
votes
1
answer
300
views
1
answer
ValueError("End of file without quality information.") when using SeqIO
... Hi! I'm trying to read in a fastQ file and carry out some operations on it (Demultiplexing the file into various fastq files based on exact matching barcodes) Midway through the fastQ file, I'm getting the following error : ValueError: End of file without quality information.   try: ...
python fastq seqio fastqgeneraliterator biopython written 6 months ago by Arko30 • updated 6 months ago by RamRS25k
0
votes
2
answers
707
views
2
answers
Comment: C: Querying VEP using REST API
... All fields into a tsv or a csv format preferably. Something that's easy to read. Right now it's a mess when outputting into a text file directly. ...
written 13 months ago by Arko30

Latest awards to Arko

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 963 users visited in the last hour