User: lkianmehr

gravatar for lkianmehr
lkianmehr50
Reputation:
50
Status:
New User
Location:
France
Last seen:
9 hours ago
Joined:
2 years, 8 months ago
Email:
l********@unice.fr

Posts by lkianmehr

<prev • 80 results • page 1 of 8 • next >
0
votes
0
answers
194
views
0
answers
How to calculate the percentage of a repetitive motif in Fastq file
... I need to calculate the percentage of a repetitive motif (TTAGGG/CCCTAA) in my RNA-seq data (Fastq files). I used BBDUK (this command : bbduk.sh in1=R3_L002_1.fastq.gz in2=R3_L002_2.fastq.gz literal=TAACCCTAACCCTAACCCTAACCC k=24 mm=f int=f). below is an output that I've got. D1_L001: ...
fastq sequence bbtools rna-seq written 8 months ago by lkianmehr50 • updated 8 months ago by Asaf8.5k
1
vote
0
answers
215
views
0
answers
quantify tRNA-derived fragments on RNA-seq data
... I have some questions: 1- can I seek for tRNA-derived fragments or generally small coding and non-coding RNA on RNA-seq data? 2- if so, is Salmon useful for this purpose? thank you ...
trna-derived fragments salmon rna-seq written 10 months ago by lkianmehr50
1
vote
0
answers
341
views
0
answers
how should be coverage track of technical replicates of alignment visualization in BAM format?
... Hello, short read sequence alignment of RNA-seq in Bam format are visulaized using IGV, something is wrong I think, technical replicates of each sample are not exactly same, I mean coverage track of them is not identical even with same data range. Do you know it should be same? or is it normal? th ...
bam visualization igv written 17 months ago by lkianmehr50
0
votes
0
answers
473
views
0
answers
Comment: C: How to get proportion of specific sequence in fastq file
... I have got the result like below, what does it mean? contaminants determine the number of reads including that specific sequence or something else? Input: 65975862 reads 6554014910 bases. Contaminants: 195232 reads (0.30%) 19519262 bases (0.30%) Total Rem ...
written 23 months ago by lkianmehr50 • updated 23 months ago by GenoMax94k
0
votes
0
answers
473
views
0
answers
Comment: C: How to get proportion of specific sequence in fastq file
... I just want to know how many of these specific sequence are there in these paired-read sequence to get proportion of that between all? I have tried by bbduk.sh in1=D1_L001_1.fastq.gz in2=D1_L001_2 out=D1.fq literal=TAACCCTAACCCTAACCCTAACCC k=24 mm=f int=f but this command just extract all re ...
written 23 months ago by lkianmehr50 • updated 23 months ago by lakhujanivijay5.3k
2
votes
0
answers
473
views
0
answers
How to get proportion of specific sequence in fastq file
... Hello, Do you have any idea about How to get proportion of specific sequence (defined as a separate fastq file= ``` @1 TAACCCTAACCCTAACCCTAACCC + JJJJJJJJJJJJJJJJJJJJJJJJ @2 TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC + JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ ``` ) in several paired- ...
specific sequence fastq rna-seq written 23 months ago by lkianmehr50 • updated 23 months ago by shenwei3565.7k
0
votes
1
answer
700
views
1
answers
Comment: C: gene ontology analysis based on transcript biotype
... could you please make some example of those specialized databases annotate gene ontology or functional terms from lncRNAs as well and which stage you recommend to separate protein_codings before DGE analysis or doesn't matter if done after that? ...
written 2.0 years ago by lkianmehr50
1
vote
1
answer
700
views
1
answer
gene ontology analysis based on transcript biotype
... I have a list of transcripts (quantified by Salmon), may I filtered them out based on biotype, for instance, protein_codings or lncRNA, then do GO for each one separately? ...
biotype gene ontology transcript written 2.0 years ago by lkianmehr50 • updated 2.0 years ago by EagleEye6.7k
0
votes
0
answers
976
views
0
answers
how do normalization for transcript length
... I have got transcript quantification by Salmon, then import them to tximport and got transcript count, length and abundances. now I would like to make a transcript coverage graph in terms of normalized counts on normalized position along transcript. I have normalized counts by DESeq2 but I don't kno ...
tximport transcript coverage salmon plot written 2.0 years ago by lkianmehr50
0
votes
1
answer
34k
views
1
answers
Comment: C: Gene Set Clustering based on Functional annotation (GeneSCF)
... geneSCF-master-source-v1.1-p2 ...
written 2.0 years ago by lkianmehr50

Latest awards to lkianmehr

Popular Question 7 weeks ago, created a question with more than 1,000 views. For best way to visualize bam file
Popular Question 8 months ago, created a question with more than 1,000 views. For best way to visualize bam file
Popular Question 10 months ago, created a question with more than 1,000 views. For view Bowtie2 alignment results
Popular Question 15 months ago, created a question with more than 1,000 views. For view Bowtie2 alignment results
Popular Question 15 months ago, created a question with more than 1,000 views. For best way to visualize bam file
Popular Question 15 months ago, created a question with more than 1,000 views. For visualizing the file with BigWig format
Popular Question 16 months ago, created a question with more than 1,000 views. For install some bioinformatic sofwares without root
Popular Question 16 months ago, created a question with more than 1,000 views. For view Bowtie2 alignment results
Popular Question 16 months ago, created a question with more than 1,000 views. For best way to visualize bam file
Popular Question 17 months ago, created a question with more than 1,000 views. For visualizing the file with BigWig format
Popular Question 18 months ago, created a question with more than 1,000 views. For visualizing the file with BigWig format
Supporter 2.2 years ago, voted at least 25 times.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2215 users visited in the last hour
_