User: lkianmehr

gravatar for lkianmehr
lkianmehr30
Reputation:
30
Status:
New User
Location:
France
Last seen:
2 days, 14 hours ago
Joined:
1 year, 5 months ago
Email:
l********@unice.fr

Posts by lkianmehr

<prev • 78 results • page 1 of 8 • next >
1
vote
0
answers
148
views
0
answers
how should be coverage track of technical replicates of alignment visualization in BAM format?
... Hello, short read sequence alignment of RNA-seq in Bam format are visulaized using IGV, something is wrong I think, technical replicates of each sample are not exactly same, I mean coverage track of them is not identical even with same data range. Do you know it should be same? or is it normal? th ...
bam visualization igv written 7 weeks ago by lkianmehr30
0
votes
0
answers
253
views
0
answers
Comment: C: How to get proportion of specific sequence in fastq file
... I have got the result like below, what does it mean? contaminants determine the number of reads including that specific sequence or something else? Input: 65975862 reads 6554014910 bases. Contaminants: 195232 reads (0.30%) 19519262 bases (0.30%) Total Rem ...
written 7 months ago by lkianmehr30 • updated 7 months ago by genomax73k
0
votes
0
answers
253
views
0
answers
Comment: C: How to get proportion of specific sequence in fastq file
... I just want to know how many of these specific sequence are there in these paired-read sequence to get proportion of that between all? I have tried by bbduk.sh in1=D1_L001_1.fastq.gz in2=D1_L001_2 out=D1.fq literal=TAACCCTAACCCTAACCCTAACCC k=24 mm=f int=f but this command just extract all re ...
written 7 months ago by lkianmehr30 • updated 7 months ago by lakhujanivijay4.5k
2
votes
0
answers
253
views
0
answers
How to get proportion of specific sequence in fastq file
... Hello, Do you have any idea about How to get proportion of specific sequence (defined as a separate fastq file= ``` @1 TAACCCTAACCCTAACCCTAACCC + JJJJJJJJJJJJJJJJJJJJJJJJ @2 TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC + JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ ``` ) in several paired- ...
specific sequence fastq rna-seq written 7 months ago by lkianmehr30 • updated 7 months ago by shenwei3564.8k
0
votes
1
answer
332
views
1
answers
Comment: C: gene ontology analysis based on transcript biotype
... could you please make some example of those specialized databases annotate gene ontology or functional terms from lncRNAs as well and which stage you recommend to separate protein_codings before DGE analysis or doesn't matter if done after that? ...
written 9 months ago by lkianmehr30
1
vote
1
answer
332
views
1
answer
gene ontology analysis based on transcript biotype
... I have a list of transcripts (quantified by Salmon), may I filtered them out based on biotype, for instance, protein_codings or lncRNA, then do GO for each one separately? ...
biotype gene ontology transcript written 9 months ago by lkianmehr30 • updated 9 months ago by EagleEye6.5k
0
votes
0
answers
359
views
0
answers
how do normalization for transcript length
... I have got transcript quantification by Salmon, then import them to tximport and got transcript count, length and abundances. now I would like to make a transcript coverage graph in terms of normalized counts on normalized position along transcript. I have normalized counts by DESeq2 but I don't kno ...
tximport transcript coverage salmon plot written 9 months ago by lkianmehr30
0
votes
1
answer
28k
views
1
answers
Comment: C: Gene Set Clustering based on Functional annotation (GeneSCF)
... geneSCF-master-source-v1.1-p2 ...
written 9 months ago by lkianmehr30
0
votes
1
answer
28k
views
1
answers
Comment: C: Gene Set Clustering based on Functional annotation (GeneSCF)
... I have tried to do GO with genescf as I did for the same gene symbols list by DAVID, but results with genescf are very different, and no P-values is significant (based on EASE less than 0.05). need to mention that I have used mgi as -db. DO you have any idea about this conflict? ...
written 9 months ago by lkianmehr30
2
votes
1
answer
370
views
1
answer
some questions to do GO enrichment analysis
... Hello, I have a list of MOUSE genes (from RNA-seq analysis) include 800 up and 7150 down regulated from DESeq2 . I did GO enrichment analysis for up-regulated genes by DAVID, and got 3 list of functional groups (84 GO term for Molecular function, 57 GO term for cellular component and 163 Go term f ...
mouse gene ontology rna-seq written 9 months ago by lkianmehr30 • updated 12 weeks ago by Biostar ♦♦ 20

Latest awards to lkianmehr

Popular Question 6 weeks ago, created a question with more than 1,000 views. For install some bioinformatic sofwares without root
Popular Question 6 weeks ago, created a question with more than 1,000 views. For view Bowtie2 alignment results
Popular Question 6 weeks ago, created a question with more than 1,000 views. For best way to visualize bam file
Popular Question 8 weeks ago, created a question with more than 1,000 views. For visualizing the file with BigWig format
Popular Question 3 months ago, created a question with more than 1,000 views. For visualizing the file with BigWig format
Supporter 11 months ago, voted at least 25 times.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1031 users visited in the last hour