User: Arpssss

gravatar for Arpssss
Arpssss40
Reputation:
40
Status:
New User
Location:
Last seen:
7 years, 3 months ago
Joined:
8 years, 1 month ago
Email:
a****@gmail.com

about me

Posts by Arpssss

<prev • 45 results • page 1 of 5 • next >
0
votes
1
answer
4.6k
views
1
answers
Comment: C: Bowtie Output Meaning
... Thanks a lot. It really helps me a lot. ...
written 7.3 years ago by Arpssss40
0
votes
1
answer
4.6k
views
1
answers
Comment: C: Bowtie Output Meaning
... Thanks a lot. It really helps me a lot. ...
written 7.3 years ago by Arpssss40
0
votes
1
answer
4.6k
views
1
answers
Comment: C: Bowtie Output Meaning
... Thanks. But, can you help me: I can't understand the meaning of: last column of the BowTie output. In manual it describes as: "A single descriptor has the format offset:reference-base>read-base. The offset is expressed as a 0-based offset from the high-quality (5') end of the read." What doe ...
written 7.3 years ago by Arpssss40
2
votes
1
answer
4.6k
views
1
answer
Bowtie Output Meaning
... I have to find matching of short reads of a .fq file onto human genome. I am using BowTie for that. Here is one read of my input file: @10_71499258_71499890_0_1_0_0_1:0:0_2:0:0_0/1 TATTAGATCGTGTGATTATATTTGACAGGTCTTAATTGACGCGCTGTTCAGCCCTTTGAGTTCGGTTGAGTTTTGGGTTGGAGAATTTTCTTCCACAAGG + 22222222222222 ...
bowtie2 bowtie written 7.3 years ago by Arpssss40 • updated 7.3 years ago by Matt LaFave290
0
votes
1
answer
1.6k
views
1
answers
Comment: C: Bowtie Accuracy
... No, I want to measure it for our databases. How much, false positive it gives ? ...
written 7.8 years ago by Arpssss40
1
vote
1
answer
1.6k
views
1
answer
Bowtie Accuracy
... I am experimenting with BowTie v 1 for various length reads (75 to 200 bp). Now, my task is to find it's throughput and accuracy. But, I can't understand how to find it's accuracy. Now, I was suggested to use an fully accurate tool and compare it to BowTie in-order to find accuracy. Can anybody hel ...
read next-gen bowtie alignment written 7.8 years ago by Arpssss40 • updated 5 days ago by Biostar ♦♦ 20
4
votes
2
answers
2.9k
views
2
answers
Illumina Produced Read Length
... I am comparing BowTie vs BWA for various read lengths. Now, before one year ago Illumina produced read lengths are typically 36, 75 or 100 bps which they have increased now a days. Can anybody provide me information about, what is the typical read lengths that Illumina is producing now a days. ...
illumina next-gen bwa bowtie written 7.8 years ago by Arpssss40 • updated 7.8 years ago by matted7.3k
0
votes
4
answers
3.6k
views
4
answers
Comment: C: How To Compare The Performance Of Bwa And Bowtie
... 200 bp runs is OK for for me where to find it ? I have not found any link for that. ...
written 7.8 years ago by Arpssss40
0
votes
4
answers
3.6k
views
4
answers
Comment: C: How To Compare The Performance Of Bwa And Bowtie
... But, I have not find any 240 bp read length database. How to find that ? ...
written 7.8 years ago by Arpssss40
12
votes
4
answers
3.6k
views
5 follow
4
answers
How To Compare The Performance Of Bwa And Bowtie
... I am experimenting with BowTie vs BWA. Now, I have to do experiments for various length reads. So, I am trying to find 180, 200, 240 bp read length databases. Can anybody help me where and how I can get those databases. I have tried to find here. However, unable to find. Can anybody help me on this ...
genome read alignment bwa bowtie written 7.8 years ago by Arpssss40 • updated 7.8 years ago by Ashutosh Pandey12k

Latest awards to Arpssss

Supporter 7.3 years ago, voted at least 25 times.
Popular Question 7.9 years ago, created a question with more than 1,000 views. For Issue With Sra To Fastq Conversion
Popular Question 8.0 years ago, created a question with more than 1,000 views. For Bowtie Building Index Issue

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1205 users visited in the last hour