Moderator: a.zielezinski

gravatar for a.zielezinski
a.zielezinski9.3k
Reputation:
9,290
Status:
Trusted
Location:
Website:
http://andrzejz.home.a...
Twitter:
a_zielezinski
Scholar ID:
Google Scholar Page
Last seen:
6 hours ago
Joined:
8 years, 7 months ago
Email:
a************@gmail.com

Andrzej Zielezinski

Posts by a.zielezinski

<prev • 385 results • page 2 of 39 • next >
0
votes
1
answer
342
views
1
answers
Comment: C: ID query with entrez -- invalid ID - rllib.error.HTTPError: HTTP Error 400: Bad
... Thank you for sharing! ...
written 5 months ago by a.zielezinski9.3k
3
votes
1
answer
342
views
1
answers
Answer: A: ID query with entrez -- invalid ID - rllib.error.HTTPError: HTTP Error 400: Bad
... You can modify your script to try downloading the sequence record three times until all fail. If all three attempts fail, skip this record. from urllib.request import urlopen from Bio import Entrez import time Entrez.email = "xxxx@xxxxx.com" IDs = ['AY851612', 'hahdshjhdasd ...
written 5 months ago by a.zielezinski9.3k
2
votes
3
answers
334
views
3
answers
Answer: A: Script to obtain human protein sequences by the gene symbols
... You can use XML as query for Ensembl. The following example is for two human gene symbols (**MT-TF** and **TNRC6A**). Format the above XML to one line and download the protein sequences using `wget`. wget -O re ...
written 5 months ago by a.zielezinski9.3k
0
votes
1
answer
188
views
1
answers
Answer: C: Makeblastdb refseq viral protein sequence (Blast db v5)
... You can find all viral protein sequences (RefSeq) here: [https://ftp.ncbi.nlm.nih.gov/refseq/release/viral/][1] [1]: https://ftp.ncbi.nlm.nih.gov/refseq/release/viral/ ...
written 6 months ago by a.zielezinski9.3k
1
vote
1
answer
333
views
1
answers
Answer: A: Online pipeline for MSA and NJ tree generation bootstrap supported
... Hi, I highly recommend on-line service [Phylogeny.fr][1]. It performs: - Multiple sequence alignment (Clustal / MUSCLE / T-Coffee / ProbCons) - MSA curation (Gblock / remove positions with gaps) - Tree construction with bootstrap (NJ / Parsimony / Maximum Likelihood / Bayes) - Tree visualizati ...
written 7 months ago by a.zielezinski9.3k
4
votes
3
answers
406
views
3
answers
Answer: A: Reverse translate to all possible codons
... Interesting question - I never thought of it that way. I ended up with something like this: import itertools d = { 'A': ['GCA', 'GCC', 'GCG', 'GCT'], 'C': ['TGC', 'TGT'], 'D': ['GAC', 'GAT'], 'E': ['GAA', 'GAG'], 'F': ['TTC', 'TTT'], 'G': ...
written 7 months ago by a.zielezinski9.3k
0
votes
1
answer
159
views
1
answers
Comment: C: leafs in the MESH tree
... Agree, the .bin extension is misleading. ...
written 9 months ago by a.zielezinski9.3k
2
votes
1
answer
159
views
1
answers
Answer: A: leafs in the MESH tree
... MeSH trees are stored in the [ftp://nlmpubs.nlm.nih.gov/online/mesh/MESH_FILES/meshtrees/mtrees2020.bin][1] text file. However, you need to parse the file to get all the leaves. Few lines from the `mtrees2020.bin` file: Infections;C01 Aneurysm, Infected;C01.069 Arthritis, Infectious;C0 ...
written 9 months ago by a.zielezinski9.3k
3
votes
1
answer
627
views
1
answers
Answer: A: Biopython gives ValueError: Sequences must all be the same length even though se
... The problem is with your `msa.phy` file. Phylip format has [certain specifications][1]. Your file should look like this: 3 253 esv1 TACGTAGGTGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGAAACTTGAGTGCAGAAGAGGAAAGCGGAATTCCACGTGT ...
written 9 months ago by a.zielezinski9.3k
2
votes
1
answer
957
views
1
answers
Comment: C: kraken and kraken2: Downloading taxonomy tree data...rsync: error while loading
... Try to install libiconv package by typing `conda install -c conda-forge libiconv` ...
written 9 months ago by a.zielezinski9.3k

Latest awards to a.zielezinski

Scholar 27 days ago, created an answer that has been accepted. For A: biopython pairwise2 result to a file
Teacher 11 weeks ago, created an answer with at least 3 up-votes. For A: biopython pairwise2 result to a file
Great Question 11 weeks ago, created a question with more than 5,000 views. For Hmmsearch (Hmmer) Tblout Format
Good Answer 3 months ago, created an answer that was upvoted at least 5 times. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Appreciated 3 months ago, created a post with more than 5 votes. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Scholar 5 months ago, created an answer that has been accepted. For A: biopython pairwise2 result to a file
Scholar 7 months ago, created an answer that has been accepted. For A: biopython pairwise2 result to a file
Teacher 7 months ago, created an answer with at least 3 up-votes. For A: biopython pairwise2 result to a file
Scholar 7 months ago, created an answer that has been accepted. For A: biopython pairwise2 result to a file
Appreciated 8 months ago, created a post with more than 5 votes. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Scholar 9 months ago, created an answer that has been accepted. For A: biopython pairwise2 result to a file
Scholar 9 months ago, created an answer that has been accepted. For A: biopython pairwise2 result to a file
Good Answer 9 months ago, created an answer that was upvoted at least 5 times. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Good Answer 10 months ago, created an answer that was upvoted at least 5 times. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Appreciated 10 months ago, created a post with more than 5 votes. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Scholar 11 months ago, created an answer that has been accepted. For A: biopython pairwise2 result to a file
Good Answer 11 months ago, created an answer that was upvoted at least 5 times. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Commentator 14 months ago, created a comment with at least 3 up-votes. For C: 200Bp Long Query Returning 201Bp
Teacher 14 months ago, created an answer with at least 3 up-votes. For A: biopython pairwise2 result to a file
Scholar 14 months ago, created an answer that has been accepted. For A: biopython pairwise2 result to a file
Commentator 15 months ago, created a comment with at least 3 up-votes. For C: 200Bp Long Query Returning 201Bp
Teacher 15 months ago, created an answer with at least 3 up-votes. For A: biopython pairwise2 result to a file
Appreciated 15 months ago, created a post with more than 5 votes. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Teacher 17 months ago, created an answer with at least 3 up-votes. For A: biopython pairwise2 result to a file
Scholar 17 months ago, created an answer that has been accepted. For A: biopython pairwise2 result to a file

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1311 users visited in the last hour