User: 2405592M

gravatar for 2405592M
2405592M10
Reputation:
10
Status:
New User
Location:
Last seen:
1 month, 1 week ago
Joined:
3 months, 1 week ago
Email:
2*******@student.gla.ac.uk

Posts by 2405592M

<prev • 10 results • page 1 of 1 • next >
0
votes
1
answer
301
views
1
answers
Comment: A: How to process paired end data (using fastq-dump) to get Fw and Rv files
... Hi guys! Sorry this is a few months later but my follow up question is related to this thread. Is it at all possible that the above SRR fastq file is in fact an interleaved fastq file. When I `more` the SRR file, this was the first few lines: @SRR1909108.1 1 length=151 TGCTCTGATGAAATCACTAA ...
written 5 weeks ago by 2405592M10
0
votes
1
answer
169
views
1
answers
Comment: C: How do you convert featureCounts output into composition of mapped reads by RNA
... Yes exactly, thats the matrix I've got ! ...
written 6 weeks ago by 2405592M10
0
votes
1
answer
169
views
1
answers
Comment: A: How do you convert featureCounts output into composition of mapped reads by RNA
... Hi EagleEye, I've already generated a table in the terminal that looks like the following: > Geneid Ctrl Treated ENSG00000223972 0 0 > ENSG00000227232 0 0 ENSG00000278267 0 0 saved as a .txt file. Would I still have to carry out 2) or would I be able to go strai ...
written 7 weeks ago by 2405592M10
1
vote
1
answer
169
views
5 follow
1
answer
How do you convert featureCounts output into composition of mapped reads by RNA class?
... Hey Guys - New to RNAseq. I used featureCounts to generate a table that has my gene id's and the counts for my untreated and treated samples (did smallRNAseq). I want to be able to convert this data into a summary by RNA class (i.e. what % of these reads are miRNA, snoRNA, rRNA etc). Can someone sha ...
featurecounts deseq2 rna-seq written 7 weeks ago by 2405592M10
0
votes
1
answer
227
views
1
answers
Comment: C: featureCounts output processing (command line)
... Thank you h.mon!! I've now combined all of my .sam files to get a new output.txt. I'm sequencing tRNAs so I was expecting multimapping and overlapping reads. I'm trying to generate a figure of some sort that shows which genes my reads are aligning to. Specifically, I want to see the difference in th ...
written 8 weeks ago by 2405592M10
0
votes
1
answer
227
views
1
answers
Comment: C: featureCounts output processing (command line)
... Yes. I used `-M` but not `-p` since I'm working with single end data ...
written 8 weeks ago by 2405592M10
0
votes
1
answer
227
views
1
answers
Comment: C: featureCounts output processing (command line)
... Thank you so much ATpoint, I see it now!! (btw my input file was .sam) I've now combined all of my .sam files (i did them seperately before) to get a new output.txt. I'm sequencing tRNAs so I was expecting multimapping and overlapping. I'm trying to generate a figure of some sort that shows which ge ...
written 8 weeks ago by 2405592M10
5
votes
1
answer
227
views
1
answer
featureCounts output processing (command line)
... Hey guys! (new to RNA-seq) I'm using featureCounts on the command line to try and quantify my aligned .SAM reads (generated in bowtie2) and I'm trying to process the resulting output files. However, it looks like my output .txt file looks nothing like what I'm seeing online. the following was my co ...
command line featurecounts rna-seq written 8 weeks ago by 2405592M10 • updated 8 weeks ago by h.mon19k
0
votes
1
answer
301
views
1
answers
Comment: C: How to process paired end data (using fastq-dump) to get Fw and Rv files
... Thanks Devon! 2 questions. 1) what would the command be? I've tried `fastq-dump --split-3 SRR1909107` but I'm still getting 1 fastq file ? 2) With regards to the ENA, can I download directly from the command line or would I have to manually download these files from the ENA website? Appreciate the h ...
written 3 months ago by 2405592M10
9
votes
1
answer
301
views
6 follow
1
answer
How to process paired end data (using fastq-dump) to get Fw and Rv files
... Hi guys. I donwloaded a fastq file using the fast-dump command (sra toolkit) to get paired end data that I want to analyse. However, the fastq file comes up as one file (was expecting two; Fw and Rv). I want to use trimmomatic which needs two input files. How do I get around this? New to the scene ...
trimmomatic fastq sra toolkit rna-seq written 3 months ago by 2405592M10

Latest awards to 2405592M

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1034 users visited in the last hour