User: 2405592M

gravatar for 2405592M
2405592M30
Reputation:
30
Status:
New User
Location:
Last seen:
2 months, 2 weeks ago
Joined:
1 year, 1 month ago
Email:
2*******@student.gla.ac.uk

Posts by 2405592M

<prev • 16 results • page 1 of 2 • next >
0
votes
1
answer
156
views
1
answers
Comment: C: Trouble manipulating dataset
... Perfect! Aggregate was the function I needed! Cheers! ...
written 10 weeks ago by 2405592M30
4
votes
1
answer
156
views
1
answer
Trouble manipulating dataset
... Hi Guys, I'm having trouble with some data manipulation. I have the following table where I have the raw counts from an RNA-seq experiment. I'm trying to group all my counts by tRNA wobble position. head(df) Isodecoder Anticodon Wobble Loci Fragment_type AAV_Ctrl1 AAV_Ctrl2 AAV_Ctrl3 AAV_Cre1 ...
R rna-seq written 11 weeks ago by 2405592M30 • updated 11 weeks ago by shawn.w.foley780
6
votes
1
answer
308
views
1
answer
Adding asterisks to a ggplot2 bar plot to show significance
... Hi guys. I'm working with a data set and I've written a for loop that generates barplots for my input tRNA data. I've been able to generate my bar plots. However, I have a column with my P values and I want to annotate on my bar plots any significant log fold changes (Padj<=0.05) with an asterisk ...
R ggplot2 rna-seq written 11 weeks ago by 2405592M30 • updated 11 weeks ago by zx87547.7k
0
votes
1
answer
240
views
1
answer
Normalization using RNA custom oligo spike-ins
... Hi guys, fairly new to RNA-seq. I used 3 custom made RNA oligos to use as spike ins in my tRNA-seq experiment. I want to normalize my dataset using these spike-ins and want to compare the normalization to a more profound normalization method (such as sizeFactors, used in DESeq2). So far, I've gener ...
normalization spike-in rna-seq written 5 months ago by 2405592M30 • updated 5 months ago by Asaf6.1k
14
votes
1
answer
309
views
6 follow
1
answer
What are SizeFactors
... Hi Guys, Im new to RNA-seq and R-programming so forgive my ignorance in advance! I'm currently using a programme/script to help me map tRNAs (the supplied notes don't explain in much detail), and after tRNA counts are generated in all my conditions, they use SizeFactors to normalize the dataset (in ...
R rna-seq normalization written 5 months ago by 2405592M30
0
votes
1
answer
365
views
1
answer
How to generate custom fasta and gtf files for RNA spike-ins
... Hi guys, I've been doing some RNA-seq on mice and I used 3x E. coli tRNA spike-ins. I'm assuming for analysis, I'll have to generate a fasta and GTF file for these spike-ins? If so, how do I do this? Also, I'm assuming this will have to be merged with the mouse fasta and GTF files. How do I do this ...
spike-in rna-seq written 8 months ago by 2405592M30 • updated 8 months ago by michael.ante3.3k
0
votes
1
answer
655
views
1
answers
Comment: A: How to process paired end data (using fastq-dump) to get Fw and Rv files
... Hi guys! Sorry this is a few months later but my follow up question is related to this thread. Is it at all possible that the above SRR fastq file is in fact an interleaved fastq file. When I `more` the SRR file, this was the first few lines: @SRR1909108.1 1 length=151 TGCTCTGATGAAATCACTAA ...
written 11 months ago by 2405592M30
0
votes
1
answer
538
views
1
answers
Comment: C: How do you convert featureCounts output into composition of mapped reads by RNA
... Yes exactly, thats the matrix I've got ! ...
written 11 months ago by 2405592M30
0
votes
1
answer
538
views
1
answers
Comment: A: How do you convert featureCounts output into composition of mapped reads by RNA
... Hi EagleEye, I've already generated a table in the terminal that looks like the following: > Geneid Ctrl Treated ENSG00000223972 0 0 > ENSG00000227232 0 0 ENSG00000278267 0 0 saved as a .txt file. Would I still have to carry out 2) or would I be able to go strai ...
written 11 months ago by 2405592M30
1
vote
1
answer
538
views
5 follow
1
answer
How do you convert featureCounts output into composition of mapped reads by RNA class?
... Hey Guys - New to RNAseq. I used featureCounts to generate a table that has my gene id's and the counts for my untreated and treated samples (did smallRNAseq). I want to be able to convert this data into a summary by RNA class (i.e. what % of these reads are miRNA, snoRNA, rRNA etc). Can someone sha ...
featurecounts deseq2 rna-seq written 11 months ago by 2405592M30

Latest awards to 2405592M

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1945 users visited in the last hour