User: 2405592M

gravatar for 2405592M
2405592M10
Reputation:
10
Status:
New User
Location:
Last seen:
5 days ago
Joined:
6 months ago
Email:
2*******@student.gla.ac.uk

Posts by 2405592M

<prev • 11 results • page 1 of 2 • next >
0
votes
1
answer
76
views
1
answer
How to generate custom fasta and gtf files for RNA spike-ins
... Hi guys, I've been doing some RNA-seq on mice and I used 3x E. coli tRNA spike-ins. I'm assuming for analysis, I'll have to generate a fasta and GTF file for these spike-ins? If so, how do I do this? Also, I'm assuming this will have to be merged with the mouse fasta and GTF files. How do I do this ...
spike-in rna-seq written 29 days ago by 2405592M10 • updated 29 days ago by michael.ante2.8k
0
votes
1
answer
391
views
1
answers
Comment: A: How to process paired end data (using fastq-dump) to get Fw and Rv files
... Hi guys! Sorry this is a few months later but my follow up question is related to this thread. Is it at all possible that the above SRR fastq file is in fact an interleaved fastq file. When I `more` the SRR file, this was the first few lines: @SRR1909108.1 1 length=151 TGCTCTGATGAAATCACTAA ...
written 4 months ago by 2405592M10
0
votes
1
answer
313
views
1
answers
Comment: C: How do you convert featureCounts output into composition of mapped reads by RNA
... Yes exactly, thats the matrix I've got ! ...
written 4 months ago by 2405592M10
0
votes
1
answer
313
views
1
answers
Comment: A: How do you convert featureCounts output into composition of mapped reads by RNA
... Hi EagleEye, I've already generated a table in the terminal that looks like the following: > Geneid Ctrl Treated ENSG00000223972 0 0 > ENSG00000227232 0 0 ENSG00000278267 0 0 saved as a .txt file. Would I still have to carry out 2) or would I be able to go strai ...
written 4 months ago by 2405592M10
1
vote
1
answer
313
views
5 follow
1
answer
How do you convert featureCounts output into composition of mapped reads by RNA class?
... Hey Guys - New to RNAseq. I used featureCounts to generate a table that has my gene id's and the counts for my untreated and treated samples (did smallRNAseq). I want to be able to convert this data into a summary by RNA class (i.e. what % of these reads are miRNA, snoRNA, rRNA etc). Can someone sha ...
featurecounts deseq2 rna-seq written 4 months ago by 2405592M10
0
votes
1
answer
402
views
1
answers
Comment: C: featureCounts output processing (command line)
... Thank you h.mon!! I've now combined all of my .sam files to get a new output.txt. I'm sequencing tRNAs so I was expecting multimapping and overlapping reads. I'm trying to generate a figure of some sort that shows which genes my reads are aligning to. Specifically, I want to see the difference in th ...
written 4 months ago by 2405592M10
0
votes
1
answer
402
views
1
answers
Comment: C: featureCounts output processing (command line)
... Yes. I used `-M` but not `-p` since I'm working with single end data ...
written 4 months ago by 2405592M10
0
votes
1
answer
402
views
1
answers
Comment: C: featureCounts output processing (command line)
... Thank you so much ATpoint, I see it now!! (btw my input file was .sam) I've now combined all of my .sam files (i did them seperately before) to get a new output.txt. I'm sequencing tRNAs so I was expecting multimapping and overlapping. I'm trying to generate a figure of some sort that shows which ge ...
written 4 months ago by 2405592M10
5
votes
1
answer
402
views
1
answer
featureCounts output processing (command line)
... Hey guys! (new to RNA-seq) I'm using featureCounts on the command line to try and quantify my aligned .SAM reads (generated in bowtie2) and I'm trying to process the resulting output files. However, it looks like my output .txt file looks nothing like what I'm seeing online. the following was my co ...
command line featurecounts rna-seq written 4 months ago by 2405592M10 • updated 4 months ago by h.mon21k
0
votes
1
answer
391
views
1
answers
Comment: C: How to process paired end data (using fastq-dump) to get Fw and Rv files
... Thanks Devon! 2 questions. 1) what would the command be? I've tried `fastq-dump --split-3 SRR1909107` but I'm still getting 1 fastq file ? 2) With regards to the ENA, can I download directly from the command line or would I have to manually download these files from the ENA website? Appreciate the h ...
written 6 months ago by 2405592M10

Latest awards to 2405592M

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2204 users visited in the last hour