User: 2405592M

gravatar for 2405592M
2405592M20
Reputation:
20
Status:
New User
Location:
Last seen:
2 weeks, 4 days ago
Joined:
8 months, 1 week ago
Email:
2*******@student.gla.ac.uk

Posts by 2405592M

<prev • 14 results • page 1 of 2 • next >
0
votes
1
answer
96
views
1
answer
Normalization using RNA custom oligo spike-ins
... Hi guys, fairly new to RNA-seq. I used 3 custom made RNA oligos to use as spike ins in my tRNA-seq experiment. I want to normalize my dataset using these spike-ins and want to compare the normalization to a more profound normalization method (such as sizeFactors, used in DESeq2). So far, I've gener ...
normalization spike-in rna-seq written 25 days ago by 2405592M20 • updated 25 days ago by Asaf5.2k
0
votes
1
answer
159
views
1
answers
Comment: A: What are SizeFactors
... Hi i.sudbery! Thank you so much for your response. Thats the best explanation I've found so far! Cheers pal! ...
written 28 days ago by 2405592M20
14
votes
1
answer
159
views
6 follow
1
answer
What are SizeFactors
... Hi Guys, Im new to RNA-seq and R-programming so forgive my ignorance in advance! I'm currently using a programme/script to help me map tRNAs (the supplied notes don't explain in much detail), and after tRNA counts are generated in all my conditions, they use SizeFactors to normalize the dataset (in ...
R rna-seq normalization written 4 weeks ago by 2405592M20
0
votes
1
answer
163
views
1
answer
How to generate custom fasta and gtf files for RNA spike-ins
... Hi guys, I've been doing some RNA-seq on mice and I used 3x E. coli tRNA spike-ins. I'm assuming for analysis, I'll have to generate a fasta and GTF file for these spike-ins? If so, how do I do this? Also, I'm assuming this will have to be merged with the mouse fasta and GTF files. How do I do this ...
spike-in rna-seq written 3 months ago by 2405592M20 • updated 3 months ago by michael.ante3.0k
0
votes
1
answer
461
views
1
answers
Comment: A: How to process paired end data (using fastq-dump) to get Fw and Rv files
... Hi guys! Sorry this is a few months later but my follow up question is related to this thread. Is it at all possible that the above SRR fastq file is in fact an interleaved fastq file. When I `more` the SRR file, this was the first few lines: @SRR1909108.1 1 length=151 TGCTCTGATGAAATCACTAA ...
written 6 months ago by 2405592M20
0
votes
1
answer
398
views
1
answers
Comment: C: How do you convert featureCounts output into composition of mapped reads by RNA
... Yes exactly, thats the matrix I've got ! ...
written 6 months ago by 2405592M20
0
votes
1
answer
398
views
1
answers
Comment: A: How do you convert featureCounts output into composition of mapped reads by RNA
... Hi EagleEye, I've already generated a table in the terminal that looks like the following: > Geneid Ctrl Treated ENSG00000223972 0 0 > ENSG00000227232 0 0 ENSG00000278267 0 0 saved as a .txt file. Would I still have to carry out 2) or would I be able to go strai ...
written 6 months ago by 2405592M20
1
vote
1
answer
398
views
5 follow
1
answer
How do you convert featureCounts output into composition of mapped reads by RNA class?
... Hey Guys - New to RNAseq. I used featureCounts to generate a table that has my gene id's and the counts for my untreated and treated samples (did smallRNAseq). I want to be able to convert this data into a summary by RNA class (i.e. what % of these reads are miRNA, snoRNA, rRNA etc). Can someone sha ...
featurecounts deseq2 rna-seq written 6 months ago by 2405592M20
0
votes
1
answer
550
views
1
answers
Comment: C: featureCounts output processing (command line)
... Thank you h.mon!! I've now combined all of my .sam files to get a new output.txt. I'm sequencing tRNAs so I was expecting multimapping and overlapping reads. I'm trying to generate a figure of some sort that shows which genes my reads are aligning to. Specifically, I want to see the difference in th ...
written 6 months ago by 2405592M20
0
votes
1
answer
550
views
1
answers
Comment: C: featureCounts output processing (command line)
... Yes. I used `-M` but not `-p` since I'm working with single end data ...
written 6 months ago by 2405592M20

Latest awards to 2405592M

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1827 users visited in the last hour