User: gbl1

gravatar for gbl1
gbl170
Reputation:
70
Status:
Trusted
Location:
Last seen:
1 day, 10 hours ago
Joined:
9 months, 2 weeks ago
Email:
g***@hi.is

Posts by gbl1

<prev • 73 results • page 1 of 8 • next >
0
votes
0
answers
52
views
0
answers
local assembly, how to proceed?
... Hello, I've got reads from on kind of fragments to a linker on a restriction site. For each sample, I have 2 series with differant restriction enzymes. Taken individually, I can assemble fragments up to 550bp. Most of them cannot be assembled. A: ------------ B: --------- ...
rad-seq illumina written 3 days ago by gbl170
0
votes
1
answer
157
views
1
answers
Comment: C: reliable way to trim
... No, hdist=1 or 2 is only working for mismatch, not for insertion/deletion I showed just 2 exemples, but it might happen everywhere… ...
written 9 days ago by gbl170
0
votes
1
answer
157
views
1
answers
Comment: C: reliable way to trim
... Hi, I actually get a small issue: CCGTGTGCGCCTCACCCCTGCATGGTGAGGACCTGCCGCA CTCGCTGT CCGTGTGCGCCTCACCCCTGCATGGTGAGGACCTGCC CAACTCGCTGT GGTGAGGACCTGCCGCAACTCGCTGT If there is a missing base in the sequence from illumina, it cannot be trimed… How to clean that? ...
written 9 days ago by gbl170
0
votes
1
answer
157
views
1
answers
Comment: C: reliable way to trim
... What are the parameter to play with in order to increase sensitivity for mismatches? >Sj-A-N_M02764:119:000000000-C5R9K:1:2115:12793:16601 CTCTGAGCCGGGGTGCCACAGGTCTGAACTCCAGTCACGGTGAGAACCTGCCGCAACTCGCTGT >Sj-A-N_M02764:119:000000000-C5R9K:1:2115:10399:16010 CTCTGAGCCGGGGTGCCA ...
written 20 days ago by gbl170
0
votes
1
answer
157
views
1
answers
Comment: C: reliable way to trim
... Grrr… I tried, and it is still the same… Actually, the java that is used is in /usr/bin/ and the newer versions are after in the path… any idea how to get it out? ...
written 21 days ago by gbl170
0
votes
1
answer
157
views
1
answers
Comment: C: reliable way to trim
... I use OSX MachincBenjamin:Leduc_PCR_MiSeq-20190221R benjamin$ java -version java version "1.6.0_51" Java(TM) SE Runtime Environment (build 1.6.0_51-b11-457) Java HotSpot(TM) 64-Bit Server VM (build 20.51-b01-457, mixed mode) ...
written 21 days ago by gbl170
0
votes
1
answer
157
views
1
answers
Comment: C: reliable way to trim
... I guess there's something wrong: MachincBenjamin:Leduc_PCR_MiSeq-20190221R benjamin$ bbduk.sh -Xmx2g in1=A008-Sj-D-N-GCTGAAGA-CAGTTTGT-Leduc-run20190221R_S8_L001_R1_001.fastq.gz in2=A008-Sj-D-N-GCTGAAGA-CAGTTTGT-Leduc-run20190221R_S8_L001_R2_001.fastq.gz literal=GGTGAGGACCTGCCGCAACTCGCTGT ktr ...
written 21 days ago by gbl170
0
votes
1
answer
157
views
1
answers
Comment: C: reliable way to trim
... Need assistence: MachincBenjamin:Leduc_PCR_MiSeq-20190221R benjamin$ /Users/benjamin/Downloads/bbmap/bbduk.sh -Xmx2g in=/Users/benjamin/Downloads/Leduc_PCR_MiSeq-20190221R/A008-Sj-D-N-GCTGAAGA-CAGTTTGT-Leduc-run20190221R_S8_L001_R2_001.fastq.gz out=trim.fa literal=GGTGAGGACCTGCCGCAACTCGCTGT ...
written 21 days ago by gbl170 • updated 21 days ago by WouterDeCoster38k
0
votes
1
answer
157
views
1
answers
Comment: C: reliable way to trim
... java -jar /Users/benjamin/Downloads/Trimmomatic-0.38/trimmomatic-0.38.jar PE -phred33 /Users/benjamin/Downloads/Leduc_PCR_MiSeq-20190221R/A001-Vs-04-P-GCTGAAGA-CAGATGTA-Leduc-run20190221R_S1_L001_R1_001.fastq.gz /Users/benjamin/Downloads/Leduc_PCR_MiSeq-20190221R/A001-Vs-04-P-GCTGAAGA-CAGATGTA-L ...
written 21 days ago by gbl170 • updated 21 days ago by genomax65k
0
votes
1
answer
157
views
1
answers
Comment: C: reliable way to trim
... adapter was add by restriction/ligation Illumina gives something with a full size primer (50 b) then there's that poly A and random bases ...
written 21 days ago by gbl170

Latest awards to gbl1

Popular Question 5 weeks ago, created a question with more than 1,000 views. For How to start with blast and a local database

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1402 users visited in the last hour