User: vellryba

gravatar for vellryba
vellryba0
Reputation:
0
Status:
New User
Last seen:
6 hours ago
Joined:
1 week, 4 days ago
Email:
v*******@seznam.cz

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by vellryba

<prev • 10 results • page 1 of 1 • next >
0
votes
1
answer
93
views
1
answers
Comment: C: How to get an aligment file to the reference in a raw format (.txt file etc).
... My samtools are version v.1.8 ...
written 5 days ago by vellryba0
0
votes
1
answer
93
views
1
answers
Comment: C: How to get an aligment file to the reference in a raw format (.txt file etc).
... I dont get an error message but this what I get back: CG************C*********** S. . TC************.*********** .C************G*********** TT************G*********** Its not in the nice readable format you show. My command - `samtools tview -d T s90_mapped-sorted.bam ref_E2_J6.fa > a ...
written 7 days ago by vellryba0 • updated 6 days ago by genomax51k
0
votes
1
answer
93
views
1
answers
Comment: C: How to get an aligment file to the reference in a raw format (.txt file etc).
... Hi, unfortunately this doesnt work for me. Any idea? My goal is to look at correlated mutations in particular reads. Wanted to extract reads that cover both of these mutations using python from the raw alignment file. Do you have any other idea how to do that? ...
written 7 days ago by vellryba0
0
votes
1
answer
93
views
1
answer
How to get an aligment file to the reference in a raw format (.txt file etc).
... Hello, is there a way to get an alignment file out? I am after something that you get after the tview command but I want it in a text file. Is there a way to do this? Thank you PS: I cannot reply to Pierre. This doesnt work for me and produces something like this: CG*********************** ...
alignment next-gen sequencing written 7 days ago by vellryba0
0
votes
2
answers
111
views
2
answers
Comment: C: sam file help for beginner
... Dear Fin, thank you very much, this is most helpful. So the first (reverse) read spans positions 392 to 625 and the forward read spans 194 to 375. The 376 - 391 are just added from the reference, is that right? Thank you! vell ...
written 7 days ago by vellryba0
0
votes
2
answers
111
views
2
answers
Comment: C: sam file help for beginner
... Hi, as I said, I have read that. Doesnt explain this to me. ...
written 7 days ago by vellryba0
5
votes
2
answers
111
views
5 follow
2
answers
sam file help for beginner
... Hello, I am new to bioinformatics and have some question about sam files. Here, the 392 refers to the left most position in reference genome where the read aligns. The 194 is the position where the second mate aligns. The TLEN is 432. How do you get to that number? I was trying to read up about this ...
assembly next-gen alignment written 7 days ago by vellryba0
0
votes
0
answers
96
views
0
answers
Comment: C: How do I extract multiple mutation that corresponds to a particular position in
... Thank you, I have pair end reads. But what do you mean by the **distance** between the read and the mate? That is what I dont get. Can you help with my questions please? Are you happy that this is the SAM file? I just ended up more confused at the moment. According to TLEN and when I subtract col ...
written 11 days ago by vellryba0
0
votes
0
answers
96
views
0
answers
Comment: A: How do I extract multiple mutation that corresponds to a particular position in
... This is the full line in the SAM: gi|11111111|ref|TT|_152_620_1:0:0_3:0:0_0 83 gi|11111113|ref|TL| 551 42 70M = 152 -469 GCGCACCACCCTGCCGTACTAGAGATGACGTAAACGCCAGCACGGACCTGTTGTGCCCCACGGACTGTTT 2222222222222222222222222222222222222222222222222222222222222222222222 AS:i:-9 XN:i:0 XM:i:3 XO:i:0 XG ...
written 11 days ago by vellryba0
0
votes
0
answers
96
views
0
answers
How do I extract multiple mutation that corresponds to a particular position in the refference but are also located on a single read?
... Hello, I am new to this and I have a couple of questions. Firstly, is there a way to extract the particular location of mutation in the context of the reference (where the position 3 of the mutation also refers to a position 3 within a reference and not to the position 3 from the sequence alignmen ...
next-gen sequence snp written 11 days ago by vellryba0

Latest awards to vellryba

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 996 users visited in the last hour