User: tw617

gravatar for tw617
tw61740
Reputation:
40
Status:
New User
Location:
Last seen:
2 months, 3 weeks ago
Joined:
1 year, 10 months ago
Email:
t***********@my.uri.edu

Posts by tw617

<prev • 22 results • page 1 of 3 • next >
0
votes
1
answer
119
views
1
answers
Comment: C: Multiple Sequence Alignment With Human Lung Infecting Coronaviruses
... Thanks! Yeah I am just wondering where to look next. I got the Springer 'Comparative Genomics' book and they have a short section on viral bioinformatics. They pretty much just tell you to run a multi sequence alignment and do not expand on the subject past that. I'm assuming that since the virus ...
written 12 weeks ago by tw61740
2
votes
1
answer
119
views
1
answer
Multiple Sequence Alignment With Human Lung Infecting Coronaviruses
... I pulled all of the human lung infecting coronaviruses on the ncbi viral variation database and ran a multiple sequence alignment using `MUSCLE`. There was ~200 or so human lung infecting fasta files that went into this alignment and it took about 2 hours to process. I cannot get much further than t ...
alignment muscle virsuses written 12 weeks ago by tw61740
0
votes
1
answer
74
views
1
answers
Comment: C: How to view MUSCLE ouput
... Thanks! I will re-run the analysis without the -html flag. Sadly it takes about 1.5 hrs :(. Does the html file have any use? ...
written 3 months ago by tw61740
2
votes
1
answer
74
views
1
answer
How to view MUSCLE ouput
... I did a multi-sequence alignment with `MUSCLE` and used -html to output a fasta file. When I use ctrl+O to view the file in my brower, it is just bland html code (it appears it shows up properly in this comment box): KP223131.1 GATTTAAGTGAATAGCTTGGCTATCTCACTTCCCCTCGTTCTCTTGCAGAACTTTGATTT The ...
muscle msa data visualization written 3 months ago by tw61740 • updated 3 months ago by Mensur Dlakic5.4k
0
votes
1
answer
167
views
1
answers
Comment: C: What to do with a bunch of Viral Genomes
... Thank you very much! I will report back with my findings (if I can figure it out :)). ...
written 3 months ago by tw61740
4
votes
1
answer
167
views
1
answer
What to do with a bunch of Viral Genomes
... I made a script to retrieve all of the recorded full-length human lung infecting coronaviruses in genbank (virus variation database, ncbi). After trimming out all of the really small files or those that didnt work, I'm left with ~200 fasta files to work with. What are some analyses I can run with th ...
alignment compartive genomics blast genomics virus written 3 months ago by tw61740
0
votes
2
answers
906
views
2
answers
Comment: C: How to find a variant in a particular position in a bam file only using samtools
... **THANK YOU!** $ samtools mpileup -v -u out.bam | grep "17375390" | cut -f 8 > out.vcf Now I just need to learn how to interpret a vcf file! ...
written 14 months ago by tw61740
0
votes
2
answers
906
views
2
answers
Comment: C: How to find a variant in a particular position in a bam file only using samtools
... Thanks for the reply but I can already see it in IGV, I need to be able to show it is there using only the bam file. I think I might need to use a particular flag on my bed file modified bam but I am having trouble figuring out which one I need or if I need them at all. ...
written 14 months ago by tw61740
3
votes
2
answers
906
views
2
answers
How to find a variant in a particular position in a bam file only using samtools
... I am trying to find a way to display the presence of a single mismatch at position chr7:17375390 on the reverse strand of an overlapping read in a bam file using only samtools. I sliced the section of the chromosome, and I can see that there is a C aligning to T in the reference at this position in ...
bam samtools sam written 14 months ago by tw61740 • updated 14 months ago by swbarnes27.7k
1
vote
1
answer
462
views
1
answers
Answer: A: model design in rna seq - deseq2
... Your method of adjusting the p-value could be too stringent. Look into the default settings of DEseq and see which method is used. We should assume there are many false positives by the nature of the test, 20 DE genes is way too low. You should check the quality of your data while you are at it too, ...
written 14 months ago by tw61740

Latest awards to tw617

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1631 users visited in the last hour