User: neilgupte7

gravatar for neilgupte7
neilgupte70
Reputation:
0
Status:
New User
Last seen:
2 months ago
Joined:
3 months ago
Email:
n*********@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by neilgupte7

<prev • 14 results • page 1 of 2 • next >
0
votes
1
answer
197
views
1
answers
Comment: C: Blast With Biopython
... I am using Anaconda Spyder to run Biopython but i dont get the output when using NcbiblastnCommandline but when i use NcbiblastpCommandline i get the output ....But the output is in following format ****Alignment**** sequence: seq2 seq2 length: 149 e value: 0.0138168 CTAGCTCGATCGATCGATGCTAAG ...
written 9 weeks ago by neilgupte70
0
votes
1
answer
197
views
1
answers
Comment: C: Blast With Biopython
... standalone BLAST connecting it with a python sript ...
written 10 weeks ago by neilgupte70
0
votes
1
answer
197
views
1
answers
Comment: C: Blast With Biopython
... sorry ,my bad !did not pay attention towards the case ...
written 10 weeks ago by neilgupte70
0
votes
1
answer
197
views
1
answers
Comment: C: Blast With Biopython
... rendering part might also help basically i wanted to know,can we do Blast complementary strands inside biopython and visaulise the particular output.? ...
written 10 weeks ago by neilgupte70
3
votes
1
answer
197
views
1
answer
Blast With Biopython
... i wanted to blast two sequences ,but i need the query to be searched with the complement of my subject strand .and how to display such alignment inside biopython using blast? EXAMPLE: AGTC |||| AGTC OUTPUT BECOMES- --AGTC --||-- TCAG-- AGTC | ...
blast biopython pairwise alignment written 10 weeks ago by neilgupte70 • updated 10 weeks ago by gb440
0
votes
1
answer
231
views
1
answers
Comment: A: free DATABASE FOR SNP's for diabetes mellitus 2
... thanks alot for the reply .....The given site had all the information what I wanted,can continue my further work now ...
written 3 months ago by neilgupte70
6
votes
1
answer
231
views
1
answer
free DATABASE FOR SNP's for diabetes mellitus 2
... I wanted free downloadable database for snps related to diabetes mellitus 2, any link for the same will be appreciated tried finding out many sites they had seperate snp infos , but i need an all inclusive downloadable dataset ! ...
diabetes mellitus snp databases written 3 months ago by neilgupte70
0
votes
0
answers
166
views
0
answers
Comment: C: Visualisation of restriction cutting sites using Biopython
... thanks for the reply ,will try iterating them manually ...
written 3 months ago by neilgupte70
0
votes
0
answers
166
views
0
answers
Comment: C: Visualisation of restriction cutting sites using Biopython
... I have written my restriction enzyme finding code which is working fine ,now i want to use the sites got from that code to be used visualize the sites with genomediagram.....i could not find anything inside the cook books so for genome diagram i am starting with clean plate ...
written 3 months ago by neilgupte70
0
votes
0
answers
166
views
0
answers
Visualisation of restriction cutting sites using Biopython
... How to use GenomeDiagram class available in Biopython to map and show the restriction enzyme cutting sites ? The ouput should be close to snapgene outputs ...
visualization biopython restriction enzymes written 3 months ago by neilgupte70

Latest awards to neilgupte7

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1198 users visited in the last hour