User: sjunlee89

gravatar for sjunlee89
sjunlee890
Reputation:
0
Status:
New User
Last seen:
1 month ago
Joined:
7 months, 4 weeks ago
Email:
s********@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by sjunlee89

<prev • 17 results • page 1 of 2 • next >
0
votes
0
answers
120
views
0
answers
Comment: C: How can I get the information p or q-arm in chromosome based on dbSNP or others?
... I'm so sorry, I haven't noticed that post. Thank you so much for your help. ...
written 5 weeks ago by sjunlee890
2
votes
0
answers
120
views
0
answers
How can I get the information p or q-arm in chromosome based on dbSNP or others?
... I have the result of logistic analysis based on GWAS. For example, PSCA gene is located on 8 chromosome. On the other hand, I would like to know the information about p or q-arm on chromosome. PSCA is positioned 8q24.3 exactly. So, I have several SNPs that come from GWAS. How can I get the inf ...
snp written 5 weeks ago by sjunlee890
1
vote
1
answer
129
views
1
answer
What is the meaning of REF, ALT, A1 on the logistic analysis (--glm) using Plink2?
... I ran an logistic analysis (--glm) using Plink2 and got some results. Some SNPs have the same allele between REF and ALT (REF=ALT), others have the same allele between REF and A1 (REF=A1). As I know, A1 is the minor allele, however, I'm not sure what the REF, ALT, and A1 is exactly. Please let me ...
plink2 snp written 7 weeks ago by sjunlee890 • updated 7 weeks ago by Santosh Anand4.6k
0
votes
0
answers
197
views
0
answers
Comment: C: Why should the LD plot (LD heatmap) be created in control samples, not cases?
... Thank you for your reply! ...
written 9 weeks ago by sjunlee890
0
votes
1
answer
170
views
1
answers
Comment: C: What is the reference snp and alternative snp in dbsnp window?
... Thank you for your reply! ...
written 9 weeks ago by sjunlee890
3
votes
1
answer
170
views
1
answer
What is the reference snp and alternative snp in dbsnp window?
... When I searched SNP "rs2976396" in dbsnp and the result is below. rs2976396 [Homo sapiens] GTGGACTGAGTAGAACTGGAGGACA[A/G]GAGTCGACGTGAGTTCCTGGGAGTC Alleles G>A What is the reference SNP and alternative SNP? I would like to know how to interpret this. Thanks advanced. ...
tool snp written 9 weeks ago by sjunlee890 • updated 9 weeks ago by ATpoint14k
0
votes
0
answers
197
views
0
answers
Comment: C: Why should the LD plot (LD heatmap) be created in control samples, not cases?
... I'm sorry to say that I am not familiar with GWAS analsys. I read that the figures' descriptive in some of papers says "~~LD plots in ~~ controls". I would like to know what you said that "it depends on the analysis that you are doing." Thanks advanced. ...
written 9 weeks ago by sjunlee890
0
votes
0
answers
197
views
0
answers
Comment: C: Why should the LD plot (LD heatmap) be created in control samples, not cases?
... Thank you so much for your comment. Is there any specific reason why LD plot should be created in control samples? ...
written 10 weeks ago by sjunlee890
1
vote
0
answers
197
views
0
answers
Why should the LD plot (LD heatmap) be created in control samples, not cases?
... I would like to create the LD plot (LD heatmap) based on GWAS result. On the other hand, I read that the LD plot should be made in control samples, not cases. Is there any specific reason why the LD plot only comes from control samples? Thanks advanced. ...
snp written 11 weeks ago by sjunlee890
0
votes
1
answer
207
views
1
answers
Comment: C: How to generate MAP file?
... Thank you so much for your comment. ...
written 11 weeks ago by sjunlee890

Latest awards to sjunlee89

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2083 users visited in the last hour