User: abdul.suboor123

Reputation:
0
Status:
New User
Last seen:
10 hours ago
Joined:
6 months, 2 weeks ago
Email:
a**************@yahoo.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by abdul.suboor123

<prev • 31 results • page 1 of 4 • next >
0
votes
1
answer
205
views
1
answers
Answer: A: How to perform sequence validation of NGS data?
... @Bastien Hervé , I have a little knowledge of Python, but I am not good at python. Yes I have SnapGene sequences and sanger sequeced files. Please tell me the trick how I can do that? Yeah for each sequence I need a junction in sanger sequence. ...
written 4 weeks ago by abdul.suboor1230
0
votes
1
answer
205
views
1
answers
Comment: C: How to perform sequence validation of NGS data?
... For Example the SnapGene Sequence is: CTTGAAGTTATTGATAACATACTCTTAAAAATGACTGAGGAAGAATCTGCTGTGGCCGCTGCTAGCACAGGCACTGAAAAGGGGAAAAAACAAGCTGAAGACATTTTGGAGGGTGAAGATTTCGAATTTCAAGATCTACTTGGGCAAGAGCTGACAGACGCTGAAAAAGCAGAGCTTAAAAGATGTGCCATAGCCTGCGGATATAAGCCAGGGGCTACACTATTTGGTGGGGTTAACGAAGGAAAGCTGAG ...
written 5 weeks ago by abdul.suboor1230 • updated 5 weeks ago by Bastien Hervé3.3k
0
votes
1
answer
205
views
1
answers
Comment: C: How to perform sequence validation of NGS data?
... Yes you are right, if AAAAACGCGCGCGCCCCC is circDNA sequence, with snapgene when select the circular option, it create a junction site, means it connect the start and end of the circDNA sequence, i.e. junction site from the sequence is CCCCCAAAAA. These ten basis I want to confirm from the sanger se ...
written 5 weeks ago by abdul.suboor1230
0
votes
1
answer
205
views
1
answers
Comment: C: How to perform sequence validation of NGS data?
... I have tried blast and it shows that the sequence more than 90% belong to maize genome, but I want to validate its cicularity, whether it is circled or not??I know that the sequence is right, but acutally need to confirm the circularity of the DNA sequence which resulted after the application of the ...
written 5 weeks ago by abdul.suboor1230
0
votes
1
answer
205
views
1
answers
Comment: C: How to perform sequence validation of NGS data?
... For example: I have sequenced my circDNA samples of maize crop, I have analysed the data with two softwares CIRI and CIRCexplorer2 and it resulted that I have 150 circDNAs from CIRI and 188 from CIRCexplorer results. Now I want to confirm that if the sequence of circDNA is really a maize line sequen ...
written 5 weeks ago by abdul.suboor1230
0
votes
1
answer
205
views
1
answers
Comment: C: How to perform sequence validation of NGS data?
... My objective is to validate my circDNA data, If there is any other way please tell me. Can you tell me about the script use for validation through python or perl? ...
written 5 weeks ago by abdul.suboor1230
0
votes
1
answer
205
views
1
answers
Comment: C: How to perform sequence validation of NGS data?
... My NGS data is in fastQ format, whereas the sanger sequence data is in EditSeq file format. I have selected some junction reads through bedtools and then make primers for each read, and make sanger sequencing, this procedure I learn from my labmate, she perform it on circRNA data. my data is circDNA ...
written 5 weeks ago by abdul.suboor1230
3
votes
1
answer
205
views
5 follow
1
answer
How to perform sequence validation of NGS data?
... I have done analysis of circDNA NGS data, now I am validating the circDNA sequence reads with sanger sequence, but this is my 5th time I am trying on notepad++, in "find" option I put the junction site "five bases from start and five bases from end" of my circDNA sequence read, but it doesn't match. ...
circdna-seq written 5 weeks ago by abdul.suboor1230
0
votes
0
answers
243
views
0
answers
Comment: A: How to perform fusion search with Hisat2?
... @Kevin Blighe Thank you, I will try on those packages mentioned in the nature article. ...
written 12 weeks ago by abdul.suboor1230
0
votes
0
answers
243
views
0
answers
Comment: A: How to perform fursion search with Hisat2?
... Thanks @Kevin Blighe , I visited the link you provided, but there is no any solution about the problem, they are also still trying to develop it. Yeah At least I came to know that they are still developing it , not yet developed. Thanks. ...
written 12 weeks ago by abdul.suboor1230

Latest awards to abdul.suboor123

Supporter 3 months ago, voted at least 25 times.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 856 users visited in the last hour