User: abdul.suboor123

Reputation:
0
Status:
New User
Last seen:
4 days, 16 hours ago
Joined:
11 months, 3 weeks ago
Email:
a**************@yahoo.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by abdul.suboor123

<prev • 35 results • page 1 of 4 • next >
0
votes
2
answers
307
views
2
answers
Comment: C: Problem in setting pipeline for circDNA prediction analysis.
... Same error has showing, even I have Python 3.6 and installed the conda dependencies. [skabdul@mn02 M1]$ python --version Python 3.6.5 [skabdul@mn02 M1]$ conda config --add channels defaults Warning: 'defaults' already in 'channels' list, moving to the top [skabdul@mn02 M1]$ c ...
written 7 days ago by abdul.suboor1230
0
votes
2
answers
307
views
2
answers
Comment: C: Problem in setting pipeline for circDNA prediction analysis.
... Thanks for your quick response, The commands you have mentioned above are still not working with me. [skabdul@mn02 M1]$ python -m pip install Circle-Map /bin/python: No module named pip [skabdul@mn02 M1]$ conda install -c bioconda circle-map Fetching package metadata .... ...
written 7 days ago by abdul.suboor1230
0
votes
2
answers
307
views
2
answers
Comment: C: Problem in setting pipeline for circDNA prediction analysis.
... I have followed your instructions and try to use Circle-Map tool but it is showing error. Please tell me what's wrong with it. [skabdul@mn02 M1]$ circle_map.py ReadExtractor -i qname_M1_map.bam -o circular_read_candidates.bam /public/home/skabdul/software/Circle-Map-master/circlemap/cir ...
written 7 days ago by abdul.suboor1230
0
votes
0
answers
172
views
0
answers
Comment: C: Circle-Map: Sensitive detection of circular DNA at single-nucleotide resolution
... Please let me know, why it is still not working with me? below is the pipeline and the error shows when I entered the pipeline. [skabdul@mn02 M1]$ circle_map.py ReadExtractor -i qname_M1_map.bam -o circular_read_candidates.bam /public/home/skabdul/software/Circle-Map-master/circlemap/cir ...
written 7 days ago by abdul.suboor1230
0
votes
1
answer
377
views
1
answers
Answer: A: How to perform sequence validation of NGS data?
... @Bastien Hervé , I have a little knowledge of Python, but I am not good at python. Yes I have SnapGene sequences and sanger sequeced files. Please tell me the trick how I can do that? Yeah for each sequence I need a junction in sanger sequence. ...
written 6 months ago by abdul.suboor1230
0
votes
1
answer
377
views
1
answers
Comment: C: How to perform sequence validation of NGS data?
... For Example the SnapGene Sequence is: CTTGAAGTTATTGATAACATACTCTTAAAAATGACTGAGGAAGAATCTGCTGTGGCCGCTGCTAGCACAGGCACTGAAAAGGGGAAAAAACAAGCTGAAGACATTTTGGAGGGTGAAGATTTCGAATTTCAAGATCTACTTGGGCAAGAGCTGACAGACGCTGAAAAAGCAGAGCTTAAAAGATGTGCCATAGCCTGCGGATATAAGCCAGGGGCTACACTATTTGGTGGGGTTAACGAAGGAAAGCTGAG ...
written 6 months ago by abdul.suboor1230 • updated 6 months ago by Bastien Hervé4.4k
0
votes
1
answer
377
views
1
answers
Comment: C: How to perform sequence validation of NGS data?
... Yes you are right, if AAAAACGCGCGCGCCCCC is circDNA sequence, with snapgene when select the circular option, it create a junction site, means it connect the start and end of the circDNA sequence, i.e. junction site from the sequence is CCCCCAAAAA. These ten basis I want to confirm from the sanger se ...
written 6 months ago by abdul.suboor1230
0
votes
1
answer
377
views
1
answers
Comment: C: How to perform sequence validation of NGS data?
... I have tried blast and it shows that the sequence more than 90% belong to maize genome, but I want to validate its cicularity, whether it is circled or not??I know that the sequence is right, but acutally need to confirm the circularity of the DNA sequence which resulted after the application of the ...
written 6 months ago by abdul.suboor1230
0
votes
1
answer
377
views
1
answers
Comment: C: How to perform sequence validation of NGS data?
... For example: I have sequenced my circDNA samples of maize crop, I have analysed the data with two softwares CIRI and CIRCexplorer2 and it resulted that I have 150 circDNAs from CIRI and 188 from CIRCexplorer results. Now I want to confirm that if the sequence of circDNA is really a maize line sequen ...
written 6 months ago by abdul.suboor1230
0
votes
1
answer
377
views
1
answers
Comment: C: How to perform sequence validation of NGS data?
... My objective is to validate my circDNA data, If there is any other way please tell me. Can you tell me about the script use for validation through python or perl? ...
written 6 months ago by abdul.suboor1230

Latest awards to abdul.suboor123

Supporter 9 months ago, voted at least 25 times.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1010 users visited in the last hour