User: abdul.suboor123

Reputation:
0
Status:
New User
Last seen:
2 weeks ago
Joined:
2 years, 4 months ago
Email:
a**************@yahoo.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by abdul.suboor123

<prev • 42 results • page 1 of 5 • next >
1
vote
0
answers
80
views
0
answers
Is it possible to extract miRNAs from RNA seq data?
... I want to extract miRNAs from RNA-Seq data sets, is it possible? please can anyone tell me the method? I have RNA-seq data of about 600 accessions, I want to extract miRNA sequences from them. ...
mrna rna-seq mirna written 15 days ago by abdul.suboor1230
0
votes
0
answers
741
views
0
answers
Comment: C: Extracting miRNA data from RNA-Seq data set
... Brother #Hafiz.Talhamalik, If you have extracted the miRNAs from RNA-seq data, please mention here your pipeline, I will be really thankful. ...
written 15 days ago by abdul.suboor1230
0
votes
1
answer
237
views
1
answers
Comment: C: Extracting matrix columns specific to file1 and file 2, not the overlap or commo
... Thanks for your reply, yeah actually, i was extracting specific rows @Bastien Herve , it works for me. ...
written 13 months ago by abdul.suboor1230
1
vote
1
answer
237
views
1
answer
Extracting matrix columns specific to file1 and file 2, not the overlap or common?
... I have two small RNA matrix files, having almost 87% overlap. I want to extract those columns which are only specific to file 1 and specific to file 2, I am giving an example of my data: File1.Sample 1: AAAAAAACAAGGATCAACAAGACT 0.0835 0 0.2743 0.197 0.069 ...
matrix sequence columns written 13 months ago by abdul.suboor1230 • updated 13 months ago by Bastien Hervé4.9k
0
votes
0
answers
433
views
0
answers
Comment: C: splicing QTL plot
... As per my understanding, I have performed the trans - eQTL for small RNA based on genes associated SNPs , where each chromosome has shown. I am providing you the code , hope you may find it helpful. `rm(list=ls()) setwd("H:/Data/sRNA eQTL data/eQTL smallRNA related/RNA_data_results/17_6_17 ...
written 14 months ago by abdul.suboor1230
0
votes
0
answers
300
views
0
answers
How to get the reads with significant RPM?
... I am doing small RNA quantification, I have data of 338 lines (samples). Till now i have count the RPM values but I want to extract the reads with RPM value >= 0.6 , and appears more than 60 times in all lines. Please provide me any method or script to perform this step. Thanks. data file is bed ...
rpm small rna rna-seq written 14 months ago by abdul.suboor1230
1
vote
3
answers
623
views
6 follow
3
answers
How to count total small RNAs (known and novel) in my aligned reads?
... I have aligned the small RNA reads with reference genome, now I want to know the method to count the total number of small RNA both (novel and know) in my reads? any method or tool please mention here, I will be thankful. ...
small rna counts srna written 15 months ago by abdul.suboor1230 • updated 9 months ago by leukosnanos0
0
votes
2
answers
681
views
2
answers
Comment: C: Problem in setting pipeline for circDNA prediction analysis.
... Same error has showing, even I have Python 3.6 and installed the conda dependencies. [skabdul@mn02 M1]$ python --version Python 3.6.5 [skabdul@mn02 M1]$ conda config --add channels defaults Warning: 'defaults' already in 'channels' list, moving to the top [skabdul@mn02 M1]$ c ...
written 16 months ago by abdul.suboor1230
0
votes
2
answers
681
views
2
answers
Comment: C: Problem in setting pipeline for circDNA prediction analysis.
... Thanks for your quick response, The commands you have mentioned above are still not working with me. [skabdul@mn02 M1]$ python -m pip install Circle-Map /bin/python: No module named pip [skabdul@mn02 M1]$ conda install -c bioconda circle-map Fetching package metadata .... ...
written 16 months ago by abdul.suboor1230
0
votes
2
answers
681
views
2
answers
Comment: C: Problem in setting pipeline for circDNA prediction analysis.
... I have followed your instructions and try to use Circle-Map tool but it is showing error. Please tell me what's wrong with it. [skabdul@mn02 M1]$ circle_map.py ReadExtractor -i qname_M1_map.bam -o circular_read_candidates.bam /public/home/skabdul/software/Circle-Map-master/circlemap/cir ...
written 16 months ago by abdul.suboor1230

Latest awards to abdul.suboor123

Popular Question 9 months ago, created a question with more than 1,000 views. For Facing problem while performing circRNA Prediction with CIRI_AS
Popular Question 9 months ago, created a question with more than 1,000 views. For How to perform fusion search with Hisat2?
Voter 13 months ago, voted more than 100 times.
Popular Question 13 months ago, created a question with more than 1,000 views. For While using ggtree in rstudio, it shows error in some commands
Supporter 2.1 years ago, voted at least 25 times.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1047 users visited in the last hour