User: fec2

gravatar for fec2
fec230
Reputation:
30
Status:
New User
Location:
Last seen:
6 months, 1 week ago
Joined:
2 years, 3 months ago
Email:
f***@hotmail.com

Posts by fec2

<prev • 51 results • page 1 of 6 • next >
0
votes
2
answers
983
views
2
answers
Comment: C: How to match fasta header list of name?
... Thank you very much! ...
written 17 months ago by fec230
0
votes
2
answers
983
views
2
answers
Comment: C: How to match fasta header list of name?
... Hi, I have tried searching it, but couldn't found exactly same issue, as what I want is a list of name of the missing fasta file. Do you have any idea what is the key word should I use to search for this issue? Thanks. ...
written 17 months ago by fec230
13
votes
2
answers
983
views
7 follow
2
answers
How to match fasta header list of name?
... Hi, I have a multi fasta file that contains 453 fasta sequences that looks like the following: >M.Bce12308ORF4755P GTWWAC ATGCGTGACCTGATCGAAGAGCCGGGCGGCGGCGCCGCGAGCGAGGCGGAGGCGGTTCAGCCCGCCGCTGCCGTGCCGCGCGCGCTGCCGTCCGGTATCG >M.Bce1254ORF9725P GTWWAC ATGCGTGACCTGATCGAAGA ...
sequence written 17 months ago by fec230 • updated 17 months ago by shenwei3565.6k
0
votes
0
answers
451
views
0
answers
Comment: C: Local blastp option -qcov_hsp_perc
... Ya, 2 sets of proteins. I am using -subject option of blastp. ...
written 17 months ago by fec230
0
votes
0
answers
451
views
0
answers
Local blastp option -qcov_hsp_perc
... Hi all, I need to performed blastp for 2 genome (against each other). According to the paper, I need to get the number of protein which has "alignable region of the query protein sequence of more than 50%". For Blastp option, -qcov_hsp_perc should mean Percentage of Query Coverage Per HSP, right? ...
genome blast written 17 months ago by fec230
0
votes
1
answer
441
views
1
answers
Comment: C: Calculate percentage of local blast hit
... Thank you very much! ...
written 17 months ago by fec230
0
votes
1
answer
441
views
1
answers
Comment: C: Calculate percentage of local blast hit
... Hi, Thank you. However, the matrix doesn't have any label. Only has number and “.”. Could it be possible to have a label? Thanks again. ...
written 17 months ago by fec230
0
votes
1
answer
441
views
1
answers
Comment: C: Calculate percentage of local blast hit
... I m sorry, I missed out something important, the input blastp.txt should be: A B 123 B C 321 And is separate by tab. I am sorry that I missed out this part Is not A_B and B_C. ...
written 17 months ago by fec230
0
votes
1
answer
441
views
1
answers
Comment: C: Calculate percentage of local blast hit
... Could it be possible that the dataset has no self comparison? For example no A-A, B-B and C-C? ...
written 17 months ago by fec230
0
votes
1
answer
441
views
1
answers
Comment: C: Calculate percentage of local blast hit
... Hi, I got an error as below: cmd. line:1: (FILENAME=blastp_re.txt FNR=6) fatal: division by zero attempted ...
written 17 months ago by fec230

Latest awards to fec2

Popular Question 21 months ago, created a question with more than 1,000 views. For How to concatenate multiple fasta file

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1039 users visited in the last hour