User: fec2

gravatar for fec2
fec220
Reputation:
20
Status:
New User
Location:
Last seen:
4 months ago
Joined:
1 year, 4 months ago
Email:
f***@hotmail.com

Posts by fec2

<prev • 51 results • page 1 of 6 • next >
0
votes
2
answers
296
views
2
answers
Comment: C: How to match fasta header list of name?
... Thank you very much! ...
written 5 months ago by fec220
0
votes
2
answers
296
views
2
answers
Comment: C: How to match fasta header list of name?
... Hi, I have tried searching it, but couldn't found exactly same issue, as what I want is a list of name of the missing fasta file. Do you have any idea what is the key word should I use to search for this issue? Thanks. ...
written 5 months ago by fec220
13
votes
2
answers
296
views
7 follow
2
answers
How to match fasta header list of name?
... Hi, I have a multi fasta file that contains 453 fasta sequences that looks like the following: >M.Bce12308ORF4755P GTWWAC ATGCGTGACCTGATCGAAGAGCCGGGCGGCGGCGCCGCGAGCGAGGCGGAGGCGGTTCAGCCCGCCGCTGCCGTGCCGCGCGCGCTGCCGTCCGGTATCG >M.Bce1254ORF9725P GTWWAC ATGCGTGACCTGATCGAAGA ...
sequence written 5 months ago by fec220 • updated 5 months ago by shenwei3565.0k
0
votes
0
answers
171
views
0
answers
Comment: C: Local blastp option -qcov_hsp_perc
... Ya, 2 sets of proteins. I am using -subject option of blastp. ...
written 6 months ago by fec220
0
votes
0
answers
171
views
0
answers
Local blastp option -qcov_hsp_perc
... Hi all, I need to performed blastp for 2 genome (against each other). According to the paper, I need to get the number of protein which has "alignable region of the query protein sequence of more than 50%". For Blastp option, -qcov_hsp_perc should mean Percentage of Query Coverage Per HSP, right? ...
genome blast written 6 months ago by fec220
0
votes
1
answer
334
views
1
answers
Comment: C: Calculate percentage of local blast hit
... Thank you very much! ...
written 6 months ago by fec220
0
votes
1
answer
334
views
1
answers
Comment: C: Calculate percentage of local blast hit
... Hi, Thank you. However, the matrix doesn't have any label. Only has number and “.”. Could it be possible to have a label? Thanks again. ...
written 6 months ago by fec220
0
votes
1
answer
334
views
1
answers
Comment: C: Calculate percentage of local blast hit
... I m sorry, I missed out something important, the input blastp.txt should be: A B 123 B C 321 And is separate by tab. I am sorry that I missed out this part Is not A_B and B_C. ...
written 6 months ago by fec220
0
votes
1
answer
334
views
1
answers
Comment: C: Calculate percentage of local blast hit
... Could it be possible that the dataset has no self comparison? For example no A-A, B-B and C-C? ...
written 6 months ago by fec220
0
votes
1
answer
334
views
1
answers
Comment: C: Calculate percentage of local blast hit
... Hi, I got an error as below: cmd. line:1: (FILENAME=blastp_re.txt FNR=6) fatal: division by zero attempted ...
written 6 months ago by fec220

Latest awards to fec2

Popular Question 9 months ago, created a question with more than 1,000 views. For How to concatenate multiple fasta file

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 892 users visited in the last hour