User: nivya.james2016

Reputation:
0
Status:
New User
Last seen:
16 hours ago
Joined:
2 weeks, 6 days ago
Email:
n**************@vitstudent.ac.in

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by nivya.james2016

<prev • 8 results • page 1 of 1 • next >
0
votes
0
answers
87
views
0
answers
Comment: C: Is it important to take the same replicates for control and treated samples?
... Thank you so much. One more query i have is; is it necessary to take same number of control and treated samples. For example: If i am taking two treated samples is it necessary to take two control samples? ...
written 7 days ago by nivya.james20160
4
votes
0
answers
87
views
0
answers
Is it important to take the same replicates for control and treated samples?
... Hi all, I am new to NGS analysis. I have this doubt; is it a must to take the same replicates for all the reads (control and treated) for performing the miRNA Seq analysis? (eg: is it must to take it like this:- rep6 of read 1 and rep6 of read 2?) Kindly help me. Thank you in advance ...
mirnaseq written 7 days ago by nivya.james20160
0
votes
0
answers
63
views
0
answers
What is the purpose of having reference genome of other species during miRDeep2?
... Hi all, I am doing miRNA Seq analysis and I am new to it. I have indexed my genome using bowtie and mapped it. Inorder to identify the known or novel miRNAs, I thought of using miRDeep2 tool. I read a protocol saying you need mature miRNA of closely related species (eg: Gorilla) for carrying out ...
mirnaseq mirdeep2 written 10 days ago by nivya.james20160
0
votes
0
answers
110
views
0
answers
Comment: A: Error while doing EdgeR fro miRNA Seq analysis
... Yes sure This was my command for executing edgeR /home/nivya/Downloads/Trinityrnaseq-v2.6.6/Analysis/DifferentialExpression/run_DE_analysis.pl \ --matrix /home/nivya/Desktop/NSCLC/miRNASeq/DEG/matrix.txt \ --method edgeR \ --samples_file sample \ --dispersion 0.1 \ --output ...
written 17 days ago by nivya.james20160
0
votes
0
answers
110
views
0
answers
Error while doing EdgeR fro miRNA Seq analysis
... Hi all, I am presently doing miRNASeq analysis. I have come across an error while doing the differential expression analysis. Could anyone please help me to rectify this error?? I am pasting the commands below; Got 3 samples, and got: 3 data fields. Header: miRNA ID Early Stage Stage III ...
mirnaseq tool edger written 17 days ago by nivya.james20160
0
votes
0
answers
122
views
0
answers
Comment: C: Cant find bowtie index files
... ok i shall try installing bowtie 1 and do the indexing. ...
written 20 days ago by nivya.james20160
0
votes
0
answers
122
views
0
answers
Comment: A: Cant find bowtie index files
... Sure Bastien The command line used for generating the index is bowtie2-build genome.fa genome I have genome.1.bt2, genome.2.bt2, genome.3.bt2, genome.4.bt2, genome.rev.1.bt2 and genome.rev.2.bt2 in /home/nivya/Desktop/NSCLC/miRNASeq/genome/ folder. Thank you in advance. ...
written 20 days ago by nivya.james20160
1
vote
0
answers
122
views
0
answers
Cant find bowtie index files
... Hi all I am new to NGS analysis. I am trying to attempt miRNA Seq analysis. But i have come across this problem. Could anyone help me? Thanks in advance. mapper.pl trim_3_SRR7189569.fastq -e -j -k TCGTATGCCGTCTTCTGCTTGT -l 18 -m -p /home/nivya/Desktop/NSCLC/miRNASeq/genome/genome -s reads_co ...
software error mirnaseq written 20 days ago by nivya.james20160 • updated 20 days ago by finswimmer5.4k

Latest awards to nivya.james2016

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1021 users visited in the last hour