User: nivya.james2016

New User
Last seen:
3 months, 1 week ago
7 months, 2 weeks ago

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by nivya.james2016

<prev • 32 results • page 1 of 4 • next >
Comment: C: Error Runnin miRDeep2
... Hi jon.brate I am new to NGS. I got the same error as above and i am trying to do as you said. But i have a doubt. should i delete all the characters besides ACGTNacgtn? For eg: This is one of the mirna. Here you can see 'b'. Should that character be also removed? >hsa-miR-125b-1-3p ACGGGUUAGG ...
written 3 months ago by nivya.james20160
Comment: C: How to remove special characters from text files?
... I shall do it. Thank You. ...
written 4 months ago by nivya.james20160
How to rectify error?
... Hi all, Could you help me rectify this error? mkdir mirdeep_runs/run_13_12_2018_t_16_20_32 #testing input files #testing input files started: 16:20:33 /home/shanthi/Desktop/Nivya/miRBase/mature_human_miRNA1.fa Error: problem with /home/shanthi/Des ... written 4 months ago by nivya.james20160 • updated 4 months ago by finswimmer11k
Comment: C: How to remove special characters from text files?
... After this when i was running, i got this error mkdir mirdeep_runs/run_13_12_2018_t_16_20_32 #testing input files #testing input files started: 16:20:33 /home/shanthi/Desktop/Nivya/miRBase/mature_human_miRNA1.fa Error: problem with /hom ...
written 4 months ago by nivya.james20160
Comment: C: How to remove special characters from text files?
... Thank you so much finswimmer. ...
written 4 months ago by nivya.james20160
Comment: C: How to remove special characters from text files?
... Thank You So Much kathirvel. I was able to do it. ...
written 4 months ago by nivya.james20160
How to remove special characters from text files?
... Hi all I have an miRNA text file (having ~2000 miRNA information) like the following >hsa-miR-576-3p MIMAT0004796 AAGAUGUGGAAAAAUUGGAAUC >hsa-miR-140-5p MIMAT0000431 CAGUGGUUUUACCCUAUGGUAG i want it to become >hsa-miR-576-3p AAGAUGUGGAAAAAUUGGAAUC >hsa-mi ...
ubuntu textfiles mirnafiles written 4 months ago by nivya.james20160 • updated 4 months ago by finswimmer11k
Comment: C: mirDeep2 mapping error
... Thank You so much Bastein i was able to get the results when done like you suggested. ...
written 4 months ago by nivya.james20160
Comment: C: mirDeep2 mapping error
... Ok. I shall check it. Thank you so much. ...
written 4 months ago by nivya.james20160
Comment: C: mirDeep2 mapping error
... yes i do have genome directory with .ebwt files.. but there are no log files other than .ebwt files inside. but after doing the function there is a bowtie log file. Kindly check these files Could not locate a Bowtie index corresponding to basename "genome" Command: bowtie -p 1 -f ...
written 4 months ago by nivya.james20160

Latest awards to nivya.james2016

No awards yet. Soon to come :-)


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1488 users visited in the last hour