User: nivya.james2016

Reputation:
0
Status:
New User
Last seen:
5 days, 12 hours ago
Joined:
4 months, 1 week ago
Email:
n**************@vitstudent.ac.in

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by nivya.james2016

<prev • 32 results • page 1 of 4 • next >
0
votes
1
answer
1.5k
views
1
answers
Comment: C: Error Runnin miRDeep2
... Hi jon.brate I am new to NGS. I got the same error as above and i am trying to do as you said. But i have a doubt. should i delete all the characters besides ACGTNacgtn? For eg: This is one of the mirna. Here you can see 'b'. Should that character be also removed? >hsa-miR-125b-1-3p ACGGGUUAGG ...
written 25 days ago by nivya.james20160
0
votes
1
answer
131
views
1
answers
Comment: C: How to remove special characters from text files?
... I shall do it. Thank You. ...
written 4 weeks ago by nivya.james20160
1
vote
0
answers
86
views
0
answers
How to rectify mirdeep.pl error?
... Hi all, Could you help me rectify this error? mkdir mirdeep_runs/run_13_12_2018_t_16_20_32 #testing input files #testing input files started: 16:20:33 sanity_check_mature_ref.pl /home/shanthi/Desktop/Nivya/miRBase/mature_human_miRNA1.fa Error: problem with /home/shanthi/Des ...
mirdeep2.pl written 4 weeks ago by nivya.james20160 • updated 4 weeks ago by finswimmer8.8k
0
votes
1
answer
131
views
1
answers
Comment: C: How to remove special characters from text files?
... After this when i was running miRDeep2.pl, i got this error mkdir mirdeep_runs/run_13_12_2018_t_16_20_32 #testing input files #testing input files started: 16:20:33 sanity_check_mature_ref.pl /home/shanthi/Desktop/Nivya/miRBase/mature_human_miRNA1.fa Error: problem with /hom ...
written 4 weeks ago by nivya.james20160
0
votes
1
answer
131
views
1
answers
Comment: C: How to remove special characters from text files?
... Thank you so much finswimmer. ...
written 4 weeks ago by nivya.james20160
0
votes
1
answer
131
views
1
answers
Comment: C: How to remove special characters from text files?
... Thank You So Much kathirvel. I was able to do it. ...
written 4 weeks ago by nivya.james20160
2
votes
1
answer
131
views
1
answer
How to remove special characters from text files?
... Hi all I have an miRNA text file (having ~2000 miRNA information) like the following >hsa-miR-576-3p MIMAT0004796 AAGAUGUGGAAAAAUUGGAAUC >hsa-miR-140-5p MIMAT0000431 CAGUGGUUUUACCCUAUGGUAG i want it to become >hsa-miR-576-3p AAGAUGUGGAAAAAUUGGAAUC >hsa-mi ...
ubuntu textfiles mirnafiles written 4 weeks ago by nivya.james20160 • updated 4 weeks ago by finswimmer8.8k
0
votes
1
answer
144
views
1
answers
Comment: C: mirDeep2 mapping error
... Thank You so much Bastein i was able to get the results when done like you suggested. ...
written 5 weeks ago by nivya.james20160
0
votes
1
answer
144
views
1
answers
Comment: C: mirDeep2 mapping error
... Ok. I shall check it. Thank you so much. ...
written 6 weeks ago by nivya.james20160
0
votes
1
answer
144
views
1
answers
Comment: C: mirDeep2 mapping error
... yes i do have genome directory with .ebwt files.. but there are no log files other than .ebwt files inside. but after doing the mapper.pl function there is a bowtie log file. Kindly check these files Could not locate a Bowtie index corresponding to basename "genome" Command: bowtie -p 1 -f ...
written 6 weeks ago by nivya.james20160

Latest awards to nivya.james2016

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1223 users visited in the last hour