User: nivya.james2016

Reputation:
0
Status:
New User
Last seen:
1 day, 13 hours ago
Joined:
2 months, 1 week ago
Email:
n**************@vitstudent.ac.in

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by nivya.james2016

<prev • 14 results • page 1 of 2 • next >
0
votes
0
answers
89
views
0
answers
error in mapper script in miRDeep2
... Hi all I'm used the following mapper script for miRNA alignment in miRdeep2. I am getting error and also the reads_vs_genome.arf is empty. I am posting the error message herewith mapper.pl trim_3_SRR7189567.fastq -e -j -k TCGTATGCCGTCTTCTGCTTGT -l 18 -m -p /home/shanthi/Desktop/Nivya/index ...
mapper module mirdeep2 written 25 days ago by nivya.james20160 • updated 25 days ago by finswimmer6.7k
1
vote
0
answers
80
views
0
answers
miRdeep2 mapper error
... Hi all, I am trying to map my miRNA reads to the genome using the miRDeep2 mapper but is facing an error. Kindly help me. I am posting the commands used and the error below nj@nj2:~/Desktop/Fastq files/SRR7189567-stage 1A$ mapper.pl trim_3_SRR7189567.fastq -e -j -k TCGTATGCCGTCTTCTGCTTGT -l 1 ...
mirdeep2 mapper.pl written 28 days ago by nivya.james20160 • updated 28 days ago by genomax58k
0
votes
3
answers
158
views
3
answers
Comment: C: Error in cutadapt installation
... I was able to download and install cutadapt using this method. Thank you so much. ...
written 4 weeks ago by nivya.james20160
0
votes
3
answers
158
views
3
answers
Comment: C: Error in cutadapt installation
... I tried adding flags but was of no avail. ...
written 4 weeks ago by nivya.james20160
0
votes
3
answers
158
views
3
answers
Comment: C: Error in cutadapt installation
... Yes i tried but the same error as above was coming. ...
written 5 weeks ago by nivya.james20160
1
vote
3
answers
158
views
3
answers
Error in cutadapt installation
... Hi all, I am trying to install cutadapt in ububtu 14.04.4 LTS. I am unable to install due to SSL errors. Here i am attaching the error commands generated. Could anyone help me in installing this tool? $ sudo pip install cutadapt Downloading/unpacking cutadapt Cleaning up... E ...
cutadapt written 5 weeks ago by nivya.james20160 • updated 5 weeks ago by dariober9.7k
0
votes
0
answers
142
views
0
answers
Comment: C: Is it important to take the same replicates for control and treated samples?
... Thank you so much. One more query i have is; is it necessary to take same number of control and treated samples. For example: If i am taking two treated samples is it necessary to take two control samples? ...
written 8 weeks ago by nivya.james20160
4
votes
0
answers
142
views
0
answers
Is it important to take the same replicates for control and treated samples?
... Hi all, I am new to NGS analysis. I have this doubt; is it a must to take the same replicates for all the reads (control and treated) for performing the miRNA Seq analysis? (eg: is it must to take it like this:- rep6 of read 1 and rep6 of read 2?) Kindly help me. Thank you in advance ...
mirnaseq written 8 weeks ago by nivya.james20160
0
votes
0
answers
99
views
0
answers
What is the purpose of having reference genome of other species during miRDeep2?
... Hi all, I am doing miRNA Seq analysis and I am new to it. I have indexed my genome using bowtie and mapped it. Inorder to identify the known or novel miRNAs, I thought of using miRDeep2 tool. I read a protocol saying you need mature miRNA of closely related species (eg: Gorilla) for carrying out ...
mirnaseq mirdeep2 written 8 weeks ago by nivya.james20160
0
votes
0
answers
180
views
0
answers
Comment: A: Error while doing EdgeR fro miRNA Seq analysis
... Yes sure This was my command for executing edgeR /home/nivya/Downloads/Trinityrnaseq-v2.6.6/Analysis/DifferentialExpression/run_DE_analysis.pl \ --matrix /home/nivya/Desktop/NSCLC/miRNASeq/DEG/matrix.txt \ --method edgeR \ --samples_file sample \ --dispersion 0.1 \ --output ...
written 9 weeks ago by nivya.james20160

Latest awards to nivya.james2016

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1920 users visited in the last hour