User: nivya.james2016

Reputation:
0
Status:
New User
Last seen:
1 year, 9 months ago
Joined:
2 years, 1 month ago
Email:
n**************@vitstudent.ac.in

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by nivya.james2016

<prev • 32 results • page 2 of 4 • next >
0
votes
1
answer
619
views
1
answers
Comment: C: mirDeep2 mapping error
... Yes. i checked again. It is the same index name that i have provided after -p option. ...
written 23 months ago by nivya.james20160
0
votes
1
answer
619
views
1
answers
Comment: C: mirDeep2 mapping error
... i used the command to generate bowtie files bowtie-build genome.fa genome ...
written 23 months ago by nivya.james20160
2
votes
1
answer
619
views
1
answer
mirDeep2 mapping error
... Hi all, Kindly help me with this issue shanthi@shanthi-client2:~/Desktop/Nivya/Fastq files/SRR7189567-stage 1A$ mapper.pl trim_3_SRR7189567.fastq -e -j -k TCGTATGCCGTCTTCTGCTTGT -l 18 -m -p genome -s reads_collapsed.fa -t reads_collapsed_vs_genome.arf -v -n -h parsing fastq to fasta form ...
mirdeep2 mapper.pl written 23 months ago by nivya.james20160 • updated 22 months ago by Biostar ♦♦ 20
0
votes
0
answers
603
views
0
answers
Comment: C: How to uninstall mirdeep2 tool?
... Hi jrj.healey, I checked the link and was trying to do as per the instructions but came up with an error shanthi@shanthi-client2:~/Desktop/Nivya$ perl uninstall_perl_module.pl mirdeep2-master mirdeep2-master is not installed at uninstall_perl_module.pl line 15. Could you tell me whats wr ...
written 23 months ago by nivya.james20160
0
votes
0
answers
603
views
0
answers
Comment: C: How to uninstall mirdeep2 tool?
... Thank you so much jrj.healey for your help. I am trying the methods. Kindly help me again if i am not able to execute. ...
written 23 months ago by nivya.james20160
0
votes
0
answers
603
views
0
answers
Comment: C: How to uninstall mirdeep2 tool?
... thank you so much for your help. I shall do this in future. ...
written 23 months ago by nivya.james20160
0
votes
0
answers
603
views
0
answers
Comment: C: How to uninstall mirdeep2 tool?
... I downloaded it from git-hub and extracted it. Then i installed it using `sudo perl install.pl`. ...
written 23 months ago by nivya.james20160 • updated 23 months ago by finswimmer13k
2
votes
0
answers
603
views
0
answers
How to uninstall mirdeep2 tool?
... Hi all, I wanted to uninstall mirdeep2-master thats been installed in my ubuntu platform. Could someone help me with it? Thanking You in advance ...
mirdeep2 written 23 months ago by nivya.james20160
0
votes
0
answers
616
views
0
answers
error in mapper script in miRDeep2
... Hi all I'm used the following mapper script for miRNA alignment in miRdeep2. I am getting error and also the reads_vs_genome.arf is empty. I am posting the error message herewith mapper.pl trim_3_SRR7189567.fastq -e -j -k TCGTATGCCGTCTTCTGCTTGT -l 18 -m -p /home/shanthi/Desktop/Nivya/index ...
mapper module mirdeep2 written 2.0 years ago by nivya.james20160 • updated 2.0 years ago by finswimmer13k
1
vote
0
answers
438
views
0
answers
miRdeep2 mapper error
... Hi all, I am trying to map my miRNA reads to the genome using the miRDeep2 mapper but is facing an error. Kindly help me. I am posting the commands used and the error below nj@nj2:~/Desktop/Fastq files/SRR7189567-stage 1A$ mapper.pl trim_3_SRR7189567.fastq -e -j -k TCGTATGCCGTCTTCTGCTTGT -l 1 ...
mirdeep2 mapper.pl written 2.0 years ago by nivya.james20160 • updated 22 months ago by Biostar ♦♦ 20

Latest awards to nivya.james2016

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2242 users visited in the last hour