User: sdbaney

gravatar for sdbaney
sdbaney0
Reputation:
0
Status:
New User
Last seen:
4 hours ago
Joined:
5 months, 2 weeks ago
Email:
s******@millersville.edu

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by sdbaney

<prev • 18 results • page 1 of 2 • next >
0
votes
1
answer
1.0k
views
1
answers
Comment: C: DEseq three-group comparison
... wow, thank you so much for your help and manners. ...
written 3 days ago by sdbaney0
0
votes
3
answers
71
views
3
answers
Comment: C: DESEq2 Factor/Level Design
... What I meant was, what sample - which tissue has the higher/lower expression? It doesn't tell me for example, that keel is expressing a value of x. ...
written 3 days ago by sdbaney0
3
votes
3
answers
71
views
3
answers
DESEq2 Factor/Level Design
... I have 3 muscle types 1. keel 2. mantle 3. nuchal I have 3 replicates between each and want to perform differential expression across all 3 to see which transcripts are being significantly differentially expressed. I have been using Cuffdiff because it's simple and the output is nice in that it ha ...
rnas differential expression written 5 days ago by sdbaney0 • updated 5 days ago by blawney10
0
votes
0
answers
158
views
0
answers
Comment: C: Critique my Pipeline
... So you think I should avoid cuffdiff? I keep reading about this and I see a pattern. Transcriptome mapping (which is what I’m doing here, no?) focuses on transcripts present and follows the kallisto/sleuth of salmon/DESeq2/EdgeR. Whereas cuffdiff is better suited for genome mapping. The question I ...
written 28 days ago by sdbaney0
1
vote
0
answers
158
views
0
answers
Critique my Pipeline
... I have a non-model organism so no reference genome. Trying to identify differentially expressed genes contributing to muscle function (force over length extended). We performed RNASeq, then de novo assembled (Trinity) and also constructed a supertranscript to use as a reference for alignments. We ...
rna-seq differential expression written 29 days ago by sdbaney0
0
votes
3
answers
211
views
3
answers
Answer: A: Passing a file to sed to remove all lines that match +1 in file B from file A
... I wanted to give an update: I was able to accomplish this by following this post: [faSomeRecords][1] [1]: https://www.biostars.org/p/247309/ ...
written 5 weeks ago by sdbaney0
0
votes
3
answers
211
views
3
answers
Comment: C: Passing a file to sed to remove all lines that match +1 in file B from file A
... $ cat ~/Desktop/remove.txt {\rtf1\ansi\ansicpg1252\cocoartf1561\cocoasubrtf600 {\fonttbl\f0\fswiss\fcharset0 Helvetica;} {\colortbl;\red255\green255\blue255;} {\*\expandedcolortbl;;} \margl1440\margr1440\vieww10800\viewh8400\viewkind0 \pard\tx720\tx1440\tx2160\tx2880\tx3 ...
written 5 weeks ago by sdbaney0 • updated 5 weeks ago by finswimmer9.9k
0
votes
3
answers
211
views
3
answers
Comment: C: Passing a file to sed to remove all lines that match +1 in file B from file A
... $ cat ~/Desktop/kettinAlignment-wwST-strict-10hits.fasta >TRINITY_DN25900_c0_g2 CCGTTCTTTTGTACTTGTTATAATCTTTGAAGAAATCTGAGTTTGTTCATCCAGTGAGTG AACAAGCTAAGATTTCTTCAAAGATTATAACAAGTACAAAAGAACGTAAAGAGGTTGTGT CTGAAGAAACTAAGATTCAAATTGGAAAATATTAGTTTTTGCTTACTAGAAAAATGAATA AATGTATGA ...
written 5 weeks ago by sdbaney0 • updated 5 weeks ago by finswimmer9.9k
0
votes
3
answers
211
views
3
answers
Comment: C: Passing a file to sed to remove all lines that match +1 in file B from file A
... Oh okay! I can easily just have the IDs. Should it be a .txt file? I performed the following and still returned a fasta file with all of the IDs, none taken out. $ cat ~/Desktop/kettinAlignment-wwST-strict-10hits.fasta | seqkit grep -v -f ~/Desktop/remove.txt > new3.fasta The text file ...
written 5 weeks ago by sdbaney0
0
votes
3
answers
211
views
3
answers
Comment: C: Passing a file to sed to remove all lines that match +1 in file B from file A
... I get it to run successfully and it prints the result to the screen but the result doesn't have anything from fileb removed from it. It's exactly the same as the input. Here is my code: $ seqkit grep -v -f ~/Desktop/kettinAlignment-wwST-strict-3\ of\ 10hits.fasta ~/Desktop/kettinAlignment-wwST- ...
written 6 weeks ago by sdbaney0

Latest awards to sdbaney

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1324 users visited in the last hour