User: chirag.agrawal.91

Reputation:
0
Status:
New User
Last seen:
10 months, 1 week ago
Joined:
10 months, 2 weeks ago
Email:
c****************@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by chirag.agrawal.91

<prev • 4 results • page 1 of 1 • next >
0
votes
0
answers
314
views
0
answers
BWA inexact matching
... Hi, I have been trying to understand BWA algorithm. I tried running the tutorial as in - https://icb.med.cornell.edu/wiki/index.php/Elementolab/BWA_tutorial bwa aln -t 4 hg19bwaidx s_3_sequence.txt.gz > s_3_sequence.txt.bwa bwa samse hg19bwaidx s_3_sequence.txt.bwa s_3_sequence.t ...
alignment bwa written 10 months ago by chirag.agrawal.910 • updated 10 months ago by genomax70k
0
votes
1
answer
376
views
1
answers
Comment: C: BWA alignment query
... Hi, I was able to resolve the issue. My long reads file looked something like this before - `>`read1_2079_205 AGTCTCCCTCTTTGTCTCTCCCATTGACTCAGCTTTCTATGGCCTCAGATTCCCCATCCCCTTCCCAACGCCCCAGCACTGGAAGACACGTGCTGTCCCTGGTGCCGGCTCCTACGGCTAGGTCGTGGCTGGCCAGGAAATCCCCCTGGTTGGCTATGCCCCCGCTGCTCCCCCCCGCGATTACC ...
written 10 months ago by chirag.agrawal.910
0
votes
1
answer
376
views
1
answers
Comment: C: BWA alignment query
... Hi swbarnes2, Thanks for your answer. Here are my comments on your observations 1. My reference file is not empty. 2. I thought the reference file (wg.fa) is the FASTA file I am using. I don't understand which is the FASTQ file you're referring to. 3. The sam file looks something like this @SQ ...
written 10 months ago by chirag.agrawal.910
1
vote
1
answer
376
views
1
answer
BWA alignment query
... I am new to gene alignment. I am trying to align few short/long reads with a reference genome using bwa software. I have been following this tutorial - https://icb.med.cornell.edu/wiki/index.php/Elementolab/BWA_tutorial I did the following - - Downloaded bwa-0.5.9.tar.bz2 and build. - Download ...
alignment bwa written 10 months ago by chirag.agrawal.910 • updated 10 months ago by swbarnes26.2k

Latest awards to chirag.agrawal.91

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1875 users visited in the last hour