User: pltbiotech_tkarthi

Reputation:
130
Status:
Trusted
Location:
CIMMYT, Mexico
Last seen:
28 minutes ago
Joined:
5 months, 1 week ago
Email:
p*****************@outlook.com

Posts by pltbiotech_tkarthi

<prev • 49 results • page 2 of 5 • next >
1
vote
3
answers
156
views
3
answers
Answer: A: How to get the protein-domain relationship?
... Try these tools as well: https://pfam.xfam.org/search#tabview=tab0 and http://elm.eu.org/index.html ...
written 4 days ago by pltbiotech_tkarthi130
0
votes
1
answer
139
views
1
answers
Answer: A: Nonsense mutation analysis
... Great, also try to use tblastx using your nucleotide sequence as query to search against translated nucleotide database and you can see any wild or mutated version of protein from NCBI. Also try BLASTP and PSIBLAST. ...
written 4 days ago by pltbiotech_tkarthi130
0
votes
1
answer
234
views
1
answers
Comment: A: Retrieve many FASTA of the same gene from NCBI..
... Hi Pierre Lindenbaum (Administrator), I couldn't understand why not to answer to the questions in a simple way to make the query posting person understand easily? Just please go through my answer, is it not relevant to the above question? Kindly consult with moderator ATpoint to avoid contradicting ...
written 5 days ago by pltbiotech_tkarthi130
0
votes
1
answer
234
views
1
answers
Comment: A: Retrieve many FASTA of the same gene from NCBI..
... First you can go to paste your query sequence in fasta format in NCBI BLASTN for nucleotide ot BLASTP for protein. https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome Fasta format: >Species/gene/anyname tgtgggtggtgtcggtggtggtgcgtggtcgtgggtaaa ...
written 5 days ago by pltbiotech_tkarthi130
0
votes
0
answers
96
views
0
answers
Comment: A: Retrieving an operon from scaffolds : Prokaryotic Genome
... You can try https://bacteria.ensembl.org/Multi/Tools/Blast?db=core. There is zoom in and zoom out options after finding a physical location of a gene or operon and you can zoom in to findout adjacent genes or operon or domain features after having a BLASTN analysis result from the gene or fragment ...
written 9 days ago by pltbiotech_tkarthi130
0
votes
3
answers
144
views
3
answers
Answer: A: data assembling and analysis for polyploid plant
... Actually working with diploid is slightly easier than polyploids, however eventually polyploids can also act as diploid as I given example above. In lab generally people used to do doubled haploid from haploid set of chromosomes. You can read it for instance: https://www.ncbi.nlm.nih.gov/pubmed/2423 ...
written 9 days ago by pltbiotech_tkarthi130
0
votes
1
answer
340
views
1
answers
Answer: A: How to extract the mobile genetic elements
... If you want to extract novel DNA mobile elements, then you need to findout the presence of Terminal Inverted Repeats and Target Site Duplications. You could predict the TIRs using EMBOSS Einverted Repeat Server and you can manually assess the presence of TSDs, in the case of DNA transposon/MITES (a ...
written 10 days ago by pltbiotech_tkarthi130
0
votes
1
answer
147
views
1
answers
Comment: A: What does TCGA uses a a reference for making snp annotation?
... If you want to see the mutation effect of protein, you have to choose exon regions (transcript) from direct splicing or transcripts derived from alternative splicing, try to see if there are mutations. In case branch points, intron exon donor acceptor sites also crucial, since the mutations in thes ...
written 13 days ago by pltbiotech_tkarthi130
0
votes
1
answer
543
views
1
answers
Comment: A: Feature extraction from DNA sequence
... You can try to create VCF file from your data set and predict the variant effect to see the mutations are deleterious or tolerated https://www.biostars.org/p/354626/#365603 ...
written 13 days ago by pltbiotech_tkarthi130
0
votes
1
answer
263
views
1
answers
Answer: A: Mya calculation for estimation of evolutionary time scale
... Try this: https://www.biostars.org/p/368198/#368386 ...
written 13 days ago by pltbiotech_tkarthi130

Latest awards to pltbiotech_tkarthi

Scholar 4 months ago, created an answer that has been accepted. For A: mean Tajima's D value

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2103 users visited in the last hour