User: asidhu

gravatar for asidhu
asidhu10
Reputation:
10
Status:
New User
Location:
Last seen:
7 months, 1 week ago
Joined:
9 months, 1 week ago
Email:
a*****@uoguelph.ca

Posts by asidhu

<prev • 6 results • page 1 of 1 • next >
3
votes
0
answers
392
views
0
answers
Trouble with sliding window for FASTA file in python
... I'm struggling to create a sliding window that will loop through sequences (first 30 nucleotides) and identify the forward primer to later trim the primer from the sequences. The file being used as a FASTA file with around 3400 sequences. filename = "paired.fasta" min_length = 150 ...
python written 7 months ago by asidhu10 • updated 5 months ago by Biostar ♦♦ 20
0
votes
2
answers
422
views
2
answers
Comment: C: Filter DNA sequence in FASTA file by minimum length and redirect sequences that
... Thank you so much! This is exactly what I was looking for. I'm still new to python and practicing :) Just a question, if I wanted to edit the seq.fasta file such that only the good reads remained in it, is that possible? In your solution there is a new good_reads.fasta which works perfectly but if ...
written 7 months ago by asidhu10
0
votes
2
answers
422
views
2
answers
Comment: C: Filter DNA sequence in FASTA file by minimum length and redirect sequences that
... Thank you for this! I was instructed not to use Biopython otherwise this would have been the perfect method! ...
written 7 months ago by asidhu10
8
votes
2
answers
422
views
2
answers
Filter DNA sequence in FASTA file by minimum length and redirect sequences that don't meet condition to new file using python
... I am using a FASTA file with many sequences that I wish to filter. An example of the file is as follows: >SRR5533383:0::12:0:0:0: GTGCCAGCAGCCGCGGTAATACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGACTATTAAGTCAGCTGAGAAAGTTTGCGGCTCAACCGTAAAATTG$ >SRR5533383:0::19:0:0:0: G ...
python sequencing written 7 months ago by asidhu10 • updated 7 months ago by Heather Ward50
0
votes
2
answers
629
views
5 follow
2
answers
Demultiplexing before merging paired-end reads?
... I'm trying to create a pipeline that converts FASTQ --> VCF and it would include the option of single-end and paired-end reads. I am a little bit confused about how to approach this for paired-end reads as they are more complicated. For single-end pairs I've done the following steps: - Demultip ...
pandaseq sabre cutadapt written 8 months ago by asidhu10 • updated 9 weeks ago by Biostar ♦♦ 20
1
vote
1
answer
520
views
1
answer
Trouble installing and creating database for blast
... I'm using the ubuntu app to install and launch ncbi-blast-2.7.1+ on Windows 10 and I am struggling as I've been following instructions from the following tutorials: https://www.blaststation.com/intl/members/en/howtoblastwin.html https://github.com/enormandeau/ncbi_blast_tutorial/blob/master/README.m ...
fasta ubuntu blast written 9 months ago by asidhu10 • updated 9 months ago by bioexplorer4.2k

Latest awards to asidhu

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 940 users visited in the last hour