User: asidhu

gravatar for asidhu
New User
Last seen:
2 years, 1 month ago
2 years, 3 months ago

Posts by asidhu

<prev • 6 results • page 1 of 1 • next >
Trouble with sliding window for FASTA file in python
... I'm struggling to create a sliding window that will loop through sequences (first 30 nucleotides) and identify the forward primer to later trim the primer from the sequences. The file being used as a FASTA file with around 3400 sequences. filename = "paired.fasta" min_length = 150 ...
python written 2.1 years ago by asidhu10 • updated 23 months ago by Biostar ♦♦ 20
Comment: C: Filter DNA sequence in FASTA file by minimum length and redirect sequences that
... Thank you so much! This is exactly what I was looking for. I'm still new to python and practicing :) Just a question, if I wanted to edit the seq.fasta file such that only the good reads remained in it, is that possible? In your solution there is a new good_reads.fasta which works perfectly but if ...
written 2.1 years ago by asidhu10
Comment: C: Filter DNA sequence in FASTA file by minimum length and redirect sequences that
... Thank you for this! I was instructed not to use Biopython otherwise this would have been the perfect method! ...
written 2.1 years ago by asidhu10
Filter DNA sequence in FASTA file by minimum length and redirect sequences that don't meet condition to new file using python
... I am using a FASTA file with many sequences that I wish to filter. An example of the file is as follows: >SRR5533383:0::12:0:0:0: GTGCCAGCAGCCGCGGTAATACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGACTATTAAGTCAGCTGAGAAAGTTTGCGGCTCAACCGTAAAATTG$ >SRR5533383:0::19:0:0:0: G ...
python sequencing written 2.1 years ago by asidhu10 • updated 2.1 years ago by Heather Ward50
5 follow
Demultiplexing before merging paired-end reads?
... I'm trying to create a pipeline that converts FASTQ --> VCF and it would include the option of single-end and paired-end reads. I am a little bit confused about how to approach this for paired-end reads as they are more complicated. For single-end pairs I've done the following steps: - Demultip ...
pandaseq sabre cutadapt written 2.2 years ago by asidhu10 • updated 20 months ago by Biostar ♦♦ 20
Trouble installing and creating database for blast
... I'm using the ubuntu app to install and launch ncbi-blast-2.7.1+ on Windows 10 and I am struggling as I've been following instructions from the following tutorials: ...
fasta ubuntu blast written 2.3 years ago by asidhu10 • updated 2.3 years ago by lakhujanivijay5.4k

Latest awards to asidhu

No awards yet. Soon to come :-)


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1158 users visited in the last hour