User: Mimmi Ahlmén

Reputation:
0
Status:
New User
Last seen:
3 months ago
Joined:
3 months, 3 weeks ago
Email:
m***************@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by Mimmi Ahlmén

<prev • 11 results • page 1 of 2 • next >
0
votes
0
answers
161
views
0
answers
Comment: C: How to get script for inserting information in a table to work?
... CREATE TABLE orfs( orf_name TEXT, sequence TEXT, length REAL, protein TEXT ); When I look at the file my_database.db it looks like a mess. ...
written 3 months ago by Mimmi Ahlmén0
0
votes
0
answers
161
views
0
answers
How to get script for inserting information in a table to work?
... I have a file which looks like this: >orf_1 364-2160 atggcaggagcccgtggtctttggcgtgcaacagggatgaaagatactgattttggtaaa cccattattgctattgcgaattcttttacacaatttgtaccagggcatgtccatttaaaa ..... >orf_2 2453-5197 atggataataaagccacccataaaaataatttaatcccacaggccc ...
sql written 3 months ago by Mimmi Ahlmén0
0
votes
0
answers
172
views
0
answers
Promoter prediction - most probable
... Hi! When predicting promoters, are the most probable promoters the ones that starts just before any predicted gene? I'm using BPROM for the predictions and then compare them with gene predictions. ...
act gene prediction promoter prediction written 3 months ago by Mimmi Ahlmén0
0
votes
0
answers
249
views
0
answers
Comment: C: Difference between GenemarkS and getorf EMBOSS
... What do you mean by different codon usage dataset? So getorf finds ORFs and GenemarkS genes? And this is why GenemarkS found this particular gene and not getorf? ...
written 3 months ago by Mimmi Ahlmén0
1
vote
0
answers
249
views
0
answers
Difference between GenemarkS and getorf EMBOSS
... Hi! I found a gene with GenemarkS that I didn't find with getorf EMBOSS. The start codon for this gene was GTG, so GenemarkS was able to find this gene just because it is a self-trained method? Which getorf EMBOSS is not? Is this the reason? ...
orf genemarks written 3 months ago by Mimmi Ahlmén0
0
votes
1
answer
175
views
1
answers
Comment: C: Finding the start codon
... OK, thanks! So in this case the start codon is GTG? I used GenemarkS to predict this ORF. ...
written 3 months ago by Mimmi Ahlmén0
1
vote
1
answer
175
views
1
answer
Finding the start codon
... I'm trying to find the start codon in this set of bases in a gene. I'm totally new in this field so you'll have to forgive my probably very basic question. This is on the reverse strand, so should it be read in the opposite way? I used ACT to find this gene. >CDS CDS undefined product 93737 ...
artemis written 3 months ago by Mimmi Ahlmén0 • updated 3 months ago by caggtaagtat400
2
votes
1
answer
173
views
1
answer
Don't understand the assignment - Artemis
... I am currently doing an assignment were I have the genome of a prokaryote. In this assignment you will compare two methods of finding putative genes and evaluate their results. You will then further analyze the coding sequences by doing promoter predictions and comparing all the results. Use the n ...
artemis written 3 months ago by Mimmi Ahlmén0 • updated 3 months ago by lexa.matej20
0
votes
1
answer
155
views
1
answers
Comment: C: Problem with commands to run script
... Alright, and can I just type -o outputfile for the output then? ...
written 3 months ago by Mimmi Ahlmén0
1
vote
1
answer
155
views
1
answer
Problem with commands to run script
... Hi! I have to files generated from ORF finding tool and Genemark and a script that is supposed to convert them to Artemis friendly formats. Here is the instructions, but I don't get it, what should I write in the command? GenePrediction2Artemis.pl - conversion script for gene predictions. ...
perl artemis written 3 months ago by Mimmi Ahlmén0

Latest awards to Mimmi Ahlmén

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 894 users visited in the last hour