User: Mimmi Ahlmén

gravatar for Mimmi Ahlmén
Reputation:
10
Status:
New User
Location:
Last seen:
3 months, 4 weeks ago
Joined:
8 months, 3 weeks ago
Email:
m***************@gmail.com

Posts by Mimmi Ahlmén

<prev • 17 results • page 1 of 2 • next >
0
votes
0
answers
111
views
0
answers
How to compare models of evolutions with LRT?
... Hello! I'm having trouble understanding how to compare different models of evolution by using the likelihood ratio test. I know that I should compare M0 and M1a and M1a and M2a. I have the following data: M0: w=0.81; lnL=-5702.55 M1a: wo=0.50, po=0.65; w1=1.0, p1=0.35; lnL=-5650.21 M2 ...
substitutionmodels likelihoodratiotest written 4 months ago by Mimmi Ahlmén10
0
votes
6
answers
361
views
6
answers
Comment: C: How to create a tab delimited file?
... Thank you so much! Actually, my file has several elements that looks the same: XX Xxxxx_Xxxx YyyYy XY Xyxyx_Xyxyx YxYx So I need to go to then next row after each row. How do I do this? ...
written 4 months ago by Mimmi Ahlmén10
9
votes
6
answers
361
views
6 follow
6
answers
How to create a tab delimited file?
... Hi! I'm doing something wrong here. I have a long text file that look like this: AB Ana Biba 1029293.34341 And I want to print out the following to a new tab delimited file: AB Ana Biba 1029293.34341 Here's my script. Why doesn't it work? my $infile = $ARGV[0]; ...
perl written 4 months ago by Mimmi Ahlmén10 • updated 4 months ago by 5heikki8.4k
0
votes
0
answers
232
views
0
answers
Replace FASTA header and create tab-delimited file
... Hello! I'm new in bioinformatics and have a large fasta file with sequences and want to extract the header and put it in a new tab-delimited file. I also want to add a new header and put the new header in the tab-delimited file. For example: >AJ58900.1:1099-2670 Carius bactus GCAAATATTT ...
perl fasta written 4 months ago by Mimmi Ahlmén10
1
vote
1
answer
215
views
1
answer
How can I interpret the results of a likelihood ratio test between substitution models?
... I have estimated the dN/dS ratio with 3 different models: M0, M1a and M2a, this is an assignment, but I am having a hard time understanding why I had to do the following: With model M0 I fixed the value of dN/dS=1 and then estimated the value which resulted in dN/dS=0.52, LR= What can I say about t ...
paml site models likelihood ratio test written 4 months ago by Mimmi Ahlmén10 • updated 3 months ago by Asaf6.1k
3
votes
1
answer
168
views
1
answer
How to alter the program to a universal format converter
... Hello, a perl dummy here. The following script takes a input fasta file and converts it to the format swiss. How can I alter the script so that I can convert a file with any format to a new file in any other format, e.g. a universal format converter? use strict; use warnings; use B ...
perl bioseq format converter bioperl written 4 months ago by Mimmi Ahlmén10 • updated 4 months ago by JC8.0k
0
votes
0
answers
250
views
0
answers
Comment: C: How to get script for inserting information in a table to work?
... CREATE TABLE orfs( orf_name TEXT, sequence TEXT, length REAL, protein TEXT ); When I look at the file my_database.db it looks like a mess. ...
written 8 months ago by Mimmi Ahlmén10
0
votes
0
answers
250
views
0
answers
How to get script for inserting information in a table to work?
... I have a file which looks like this: >orf_1 364-2160 atggcaggagcccgtggtctttggcgtgcaacagggatgaaagatactgattttggtaaa cccattattgctattgcgaattcttttacacaatttgtaccagggcatgtccatttaaaa ..... >orf_2 2453-5197 atggataataaagccacccataaaaataatttaatcccacaggccc ...
sql written 8 months ago by Mimmi Ahlmén10
0
votes
0
answers
281
views
0
answers
Promoter prediction - most probable
... Hi! When predicting promoters, are the most probable promoters the ones that starts just before any predicted gene? I'm using BPROM for the predictions and then compare them with gene predictions. ...
act gene prediction promoter prediction written 8 months ago by Mimmi Ahlmén10
0
votes
0
answers
378
views
0
answers
Comment: C: Difference between GenemarkS and getorf EMBOSS
... What do you mean by different codon usage dataset? So getorf finds ORFs and GenemarkS genes? And this is why GenemarkS found this particular gene and not getorf? ...
written 8 months ago by Mimmi Ahlmén10

Latest awards to Mimmi Ahlmén

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1517 users visited in the last hour