User: ricardoguerreiro2121

Reputation:
20
Status:
New User
Location:
Last seen:
1 month, 3 weeks ago
Joined:
5 months, 1 week ago
Email:
r*******************@gmail.com

Posts by ricardoguerreiro2121

<prev • 12 results • page 1 of 2 • next >
0
votes
1
answer
176
views
1
answers
Comment: C: Parse raw vcf in R from CollapsedVCF (VariantAnnotation library)
... Thank you for the suggestion. I already had the answer I was looking for. The client wants an R script to run in windows, hehe. ...
written 9 weeks ago by ricardoguerreiro212120
0
votes
1
answer
176
views
1
answers
Comment: C: Parse raw vcf in R from CollapsedVCF (VariantAnnotation library)
... Perfect answer, thank you! I didn't realize VCF[-c(1, 5, 7)] would subset the vcf like if it was a vector. It only prints the metainformation but when doing info(filteredVcf) you can can see that the rows are gone. Once again thanks and have a nice day/evening! ...
written 9 weeks ago by ricardoguerreiro212120
0
votes
1
answer
176
views
1
answers
Comment: C: Parse raw vcf in R from CollapsedVCF (VariantAnnotation library)
... I know, right?? I initially did a python script and it was much easier, besides having better performance. But I need to deliver an R filter to a client that does not know (or even have installed) python... ...
written 9 weeks ago by ricardoguerreiro212120
0
votes
1
answer
176
views
1
answers
Comment: C: Parse raw vcf in R from CollapsedVCF (VariantAnnotation library)
... I have a filtering function that outputs desired indexes (based on, for example, the value of info(VCF)$MQ ) but I can't subscript VCF with indexes because it's not a dataframe or a vector. That is why I thought of parsing the raw lines as elements of a vector. I can just concatenate them to the hea ...
written 9 weeks ago by ricardoguerreiro212120
5
votes
1
answer
176
views
1
answer
Parse raw vcf in R from CollapsedVCF (VariantAnnotation library)
... Hello Simple question ( I hope!) I'm using this [VariantAnnotation][1] package from bioconductor to work with SNPs. myparam = ScanVcfParam( # this function is a fast positional filter samples="3441_pseudo_gatk", which= GRanges(chr[14], # This is a chro ...
vcf bioconductor variantannotation written 9 weeks ago by ricardoguerreiro212120
0
votes
0
answers
140
views
0
answers
Comment: C: Sequence identity between sequences with different lengths
... Great, that's it, thanks! It depends on what is the query and what is the reference. Thanks! (If you write it as an answer instead of a comment I'll accept it) ...
written 10 weeks ago by ricardoguerreiro212120
6
votes
0
answers
140
views
0
answers
Sequence identity between sequences with different lengths
... Hello, A simple question. What is the sequence identity between 2 sequences when one is much larger than the other? Example: seq1: -------------------AGTGTGAAAAAGGT---------------- seq2: ATATATGCGCATGGTAATAAGTGTGAAAAAGGTTATATGCGCATAAGGT The smaller sequence corresponds 100% to a subse ...
sequence filter mummer alignment identity written 10 weeks ago by ricardoguerreiro212120 • updated 10 weeks ago by Bastien Hervé4.0k
0
votes
1
answer
197
views
1
answers
Comment: C: Pysam VariantFile.fetch() without specifying contig
... Brilliant! Sometimes you just have to go around the problems, not force your way through. Danke schön! Ricardo ...
written 3 months ago by ricardoguerreiro212120
3
votes
1
answer
197
views
1
answer
Pysam VariantFile.fetch() without specifying contig
... Hello, I'm using the Pysam module of Python and calling the function: VF = VariantFile("input_file") VF.fetch() seems to retrieve all reads in the file, while this retrieves reads from positions 0 to 1000 in one specific contig: VF.fetch(contig="contig_name", start=0, end=100 ...
vcf python pysam written 3 months ago by ricardoguerreiro212120
0
votes
2
answers
3.8k
views
2
answers
Comment: C: Capping coverage in bam file
... Once again simple, merci bien! Keep up the helpfulness, it really makes a difference for starting researchers like me. ...
written 5 months ago by ricardoguerreiro212120

Latest awards to ricardoguerreiro2121

Supporter 10 weeks ago, voted at least 25 times.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1396 users visited in the last hour