User: genomes_and_MGEs

New User
Last seen:
6 months, 2 weeks ago
1 year, 3 months ago

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by genomes_and_MGEs

<prev • 37 results • page 1 of 4 • next >
(Closed) Move files that match the names on a list
... Hey everyone, I have a directory with several files, and I would like to move the files that match the name in a given list to another directory. Can you help me out with this? Thanks! ...
genome sequence written 6 months ago by genomes_and_MGEs0 • updated 6 months ago by badredda130
List names in column that match a given word in another column
... Hey guys, I would like to list all lines in column 1 that match a given expression in column 3. For example, 1 2 3 A B C D E F G H C ... So, I would like to list A and G, because they match the C on column 3. Btw, the match in column 3 has spaces! Thank you! ...
genome sequence written 6 months ago by genomes_and_MGEs0 • updated 6 months ago by genomax78k
Comment: C: Kill nohup bash process
... It doesn't work, because the PID is always changing on the server... So, I found a solution: pkill -STOP -P the_ppid Thanks anyway guys! ...
written 8 months ago by genomes_and_MGEs0
6 follow
Kill nohup bash process
... Hey guys, I ran this nohup bash -c 'for next in $(cat all_bacteria_links.txt); do wget -P all_bacteria "$next"/*genomic.fna.gz; done', and now I want to kill the process. I ran the command in ssh server, so whenever I try to kill PID or kill -9 PID, the server connection closes. Can you ple ...
genome sequence written 8 months ago by genomes_and_MGEs0 • updated 8 months ago by Santosh Anand5.0k
Comment: C: Download genomes within a given GC content interval
... Thanks, really appreciate that! ...
written 8 months ago by genomes_and_MGEs0
Download genomes within a given GC content interval
... Hey guys, Does anyone have a clue on how to download only complete genomes with a given GC content from NCBI? Let's say, download all complete genomes that have a GC content from 40 to 50. Thank you! ...
genome assembly sequence written 8 months ago by genomes_and_MGEs0 • updated 8 months ago by genomax78k
Comment: C: Remove text flanking .. on fasta-headers
... Thanks, saved my day! ...
written 10 months ago by genomes_and_MGEs0
6 follow
Remove text flanking .. on fasta-headers
... Hi guys, I have a multi-fasta like this >Citrobacter_freundii_D8_6645..17576 gtgatcgtcaagaaggttaagaacccgcagaaggcagca >Enterobacter_hormaechei_35012_3830..23574 atggacgatagagaaagaggcttagcatttttatttgcaatt And I would like to eliminate the numbers flanking .., to have an output ...
genome sequence written 10 months ago by genomes_and_MGEs0 • updated 10 months ago by Joe16k
Comment: C: Outputting strain name on prokka annotation
... Thanks, it's working out! Thank you for your patience, but I'm just a beginner on this. Cheers ...
written 10 months ago by genomes_and_MGEs0
Comment: C: Outputting strain name on prokka annotation
... For each, I get this java -ea -Xmx1g -cp /home/luisa/bbmap/current/ jgi.RenameReads in=Escherichia_coli_VREC0208.fasta out=Escherichia_coli_VREC0208 prefix=Escherichia_coli_VREC0208.fasta addprefix=t Executing jgi.RenameReads [in=Escherichia_coli_VREC0208.fasta, out=Escherichia_coli_VREC020 ...
written 10 months ago by genomes_and_MGEs0 • updated 10 months ago by genomax78k

Latest awards to genomes_and_MGEs

No awards yet. Soon to come :-)


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1102 users visited in the last hour