User: genomes_and_MGEs

Reputation:
0
Status:
New User
Last seen:
3 days, 6 hours ago
Joined:
5 months, 2 weeks ago
Email:
j***********@hotmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by genomes_and_MGEs

<prev • 31 results • page 1 of 4 • next >
0
votes
3
answers
116
views
3
answers
Comment: C: Remove text flanking .. on fasta-headers
... Thanks, saved my day! ...
written 26 days ago by genomes_and_MGEs0
5
votes
3
answers
116
views
6 follow
3
answers
Remove text flanking .. on fasta-headers
... Hi guys, I have a multi-fasta like this >Citrobacter_freundii_D8_6645..17576 gtgatcgtcaagaaggttaagaacccgcagaaggcagca >Enterobacter_hormaechei_35012_3830..23574 atggacgatagagaaagaggcttagcatttttatttgcaatt And I would like to eliminate the numbers flanking .., to have an output ...
genome sequence written 26 days ago by genomes_and_MGEs0 • updated 26 days ago by jrj.healey12k
0
votes
1
answer
206
views
1
answers
Comment: C: Outputting strain name on prokka annotation
... Thanks, it's working out! Thank you for your patience, but I'm just a beginner on this. Cheers ...
written 29 days ago by genomes_and_MGEs0
0
votes
1
answer
206
views
1
answers
Comment: C: Outputting strain name on prokka annotation
... For each, I get this java -ea -Xmx1g -cp /home/luisa/bbmap/current/ jgi.RenameReads in=Escherichia_coli_VREC0208.fasta out=Escherichia_coli_VREC0208 prefix=Escherichia_coli_VREC0208.fasta addprefix=t Executing jgi.RenameReads [in=Escherichia_coli_VREC0208.fasta, out=Escherichia_coli_VREC020 ...
written 29 days ago by genomes_and_MGEs0 • updated 29 days ago by genomax65k
0
votes
1
answer
206
views
1
answers
Comment: C: Outputting strain name on prokka annotation
... I tried this for F in *.fasta; do N=$(basename $F .fasta) ; bbrename.sh in=$F out=$N prefix=$F addprefix=t ; done and for F in *.fasta; do N=$(basename $F .fasta) ; bbrename.sh in=*.fasta out=$N prefix=$F addprefix=t ; done but didn't work. Can you help me optimize this? ...
written 29 days ago by genomes_and_MGEs0 • updated 29 days ago by jrj.healey12k
0
votes
0
answers
109
views
0
answers
Comment: C: Rename fasta-header based on a list
... This looks great, but I also need the accession number on the fasta header, such as >Elizabethkingia anophelis_FDAARGOS_198_NZ_CP023010_3129429..3372047 atattgagctaa.. >Klebsiella michiganensis_CAV1755_NZ_MRWY01000004_16177..110237 tcagtcgactcct... Can you help me optimize th ...
written 29 days ago by genomes_and_MGEs0 • updated 29 days ago by genomax65k
0
votes
0
answers
109
views
0
answers
Comment: C: Rename fasta-header based on a list
... Hey, sorry for insisting on this, but I still haven't solved this problem... So, I'm trying to optimize the seqkit replace command to replace the fasta-headers. Can you help me out? ...
written 4 weeks ago by genomes_and_MGEs0
0
votes
1
answer
206
views
1
answers
Comment: C: Outputting strain name on prokka annotation
... Yeah, already tried with many approaches but couldn't manage. For example, I tried this for F in *.fasta; do N=$(basename $F .fasta) ; bbrename.sh out=$N prefix=$N $F addprefix=t ; done Can you please help me optimize this? ...
written 4 weeks ago by genomes_and_MGEs0 • updated 29 days ago by h.mon24k
1
vote
0
answers
109
views
0
answers
(Closed) Rename fasta-header based on a list
... Hey everyone, I have a multi-fasta file like this >NZ_CP023010.1_3129429..3372047 atattgagctaa.. >NZ_MRWY01000004.1_16177..110237 tcagtcgactcct... ... And a list of fasta-headers like this >NZ_CP023010_Elizabethkingia anophelis FDAARGOS_198 >NZ_MRWY0100000 ...
genome sequence written 4 weeks ago by genomes_and_MGEs0 • updated 4 weeks ago by Pierre Lindenbaum119k
0
votes
1
answer
206
views
1
answers
Comment: C: Outputting strain name on prokka annotation
... Thanks, this should work! Could you please convert this into a loop? Considering I have the strain name on the fasta filename, I would have to create a loop to fetch the strain filename and output it on the fasta-header of each contig on the .fna file. Thanks! ...
written 4 weeks ago by genomes_and_MGEs0

Latest awards to genomes_and_MGEs

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2281 users visited in the last hour