User: eozcan

gravatar for eozcan
eozcan10
Reputation:
10
Status:
New User
Location:
Last seen:
an hour ago
Joined:
1 year, 11 months ago
Email:
e*****@foodsci.umass.edu

Posts by eozcan

<prev • 16 results • page 2 of 2 • next >
1
vote
0
answers
729
views
5 follow
0
answers
High no feature counts in ht-seq counts
... Hi, I know this question has been posted before but I could not find answers to increase my counts for RNA-seq reads. I have done RNA-seq in Illumina Nextseq. I prepared libraries with NEBNext Ultra II Directional library kit. I used bowtie2 to map my reads to the reference genome. It is a bacteri ...
rna-seq sequencing written 22 months ago by eozcan10
0
votes
0
answers
1.6k
views
0
answers
Comment: C: EzBioCloud for contamination of Illumina raw files
... >NS500540:135:HFF77AFXY:1:11101:6499:1061 1:N:0:ATTACTCG+NGGATAGG GGCATTACTTCGGGGTAGGTCTTAAATAAGAGCGCAATGTTGGTATAGGCTCCCGTTGGCACTAACGTAATCGGT >NS500540:135:HFF77AFXY:1:11101:23445:1062 1:N:0:ATTACTCG+NGGATAGG CGCGTTTAAAACTTGGGAATGTCTTCGTAACAGACATGCACCTCCGTTTAAACTTTGTAATACCTGAGT ...
written 22 months ago by eozcan10 • updated 22 months ago by WouterDeCoster44k
0
votes
0
answers
1.6k
views
0
answers
Comment: C: EzBioCloud for contamination of Illumina raw files
... I tried to upload a fasta concatenated file from my Illumina pair-end reads, it says "something went wrong displaying the webpage." ...
written 22 months ago by eozcan10
0
votes
0
answers
1.6k
views
0
answers
Comment: C: EzBioCloud for contamination of Illumina raw files
... here is the link. I tried fastq format, it reject that format from the beginning. https://www.ezbiocloud.net/tools/contest16s ...
written 22 months ago by eozcan10
0
votes
0
answers
1.6k
views
0
answers
EzBioCloud for contamination of Illumina raw files
... Hi, Anybody used ContEst16S: an algorithm that identifies contaminated prokaryotic genomes using 16S RNA gene sequences from EZBiocloud for Illumina files? It gives error when I upload fasta file reads from Illumina. I unzip files and convert them to fasta. It says something went wrong in a webpag ...
rna-seq sequencing written 22 months ago by eozcan10 • updated 22 months ago by genomax91k
7
votes
1
answer
2.0k
views
1
answer
has anyone use trimmomatic with NEBNext adaptors
... Hello, I am trying to remove adapters from my RNA-seq files obtained from Illumina. I used NEBNext ultra directional kit for illumina for library prep and NEBNext® Multiplex Oligos for Illumina® (Dual Index Primers Set 1) for adaptors and primers. I want to use trimmomatic, it has adapter files fo ...
rna-seq written 23 months ago by eozcan10 • updated 8 months ago by alexgoro130

Latest awards to eozcan

Popular Question 9 months ago, created a question with more than 1,000 views. For EzBioCloud for contamination of Illumina raw files
Popular Question 20 months ago, created a question with more than 1,000 views. For has anyone use trimmomatic with NEBNext adaptors

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 971 users visited in the last hour