User: Ming

gravatar for Ming
Ming0
Reputation:
0
Status:
New User
Last seen:
38 minutes ago
Joined:
4 months ago
Email:
s**************@hotmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by Ming

<prev • 12 results • page 1 of 2 • next >
0
votes
0
answers
74
views
0
answers
How much sequencing depth is required to detect a rare group of organism in environmental sample?
... Hello there, I am trying to look for a rare group of organism that is low in relative abundance in my sediment samples. I have already sequenced in on dual lanes of HiSeq 2500. What are some criteria to use to see if my sequencing depth is sufficient for this group of organisms? Thank You. ...
sequencing written 7 weeks ago by Ming0
0
votes
0
answers
88
views
0
answers
Warning when running PSI-BLAST
... Hello there, I am trying to looking for homologous genes using the PSI-BLAST function. 1.) I created a blast database of conserved genes that I had downloaded from uniprot makeblastdb -in mamA.AA.fasta -input_type fasta -dbtype prot -out mamA_db -parse_seqids 2.) I wanted to query my contigs - a ...
psi-blast written 9 weeks ago by Ming0
0
votes
0
answers
96
views
0
answers
Comment: C: Looking for homologous genes from contigs/scaffolds
... Dear @jrj.healey, Thanks for the reply and recommendation. Pan-genome ortholog clustering tool (PanOCT) does not seem to be used for metagenomics? ...
written 10 weeks ago by Ming0
0
votes
0
answers
96
views
0
answers
Looking for homologous genes from contigs/scaffolds
... Hello there, I am trying to pull out homologous genes from contigs/scaffolds that I have assembled from a metagenomics dataset. I have already constructed a fasta file of the gene family that I am interested in from Uniprot. I have read that performing PSI-BLAST with a low e-value can be used to pu ...
homologous genes written 10 weeks ago by Ming0
0
votes
1
answer
221
views
1
answers
Comment: C: Error during Spades Meta-assembly: err code: -9
... Thank you very much! ...
written 12 weeks ago by Ming0
0
votes
1
answer
161
views
1
answers
Comment: C: Appending strings to fasta header from another file
... Thank you very much for your help. :) ...
written 3 months ago by Ming0
2
votes
1
answer
221
views
1
answer
Error during Spades Meta-assembly: err code: -9
... Hello there, I was trying to run a meta-assembly on my Hi-Seq samples and I came across this error: Command line: /scratch/shiming/tools/SPAdes-3.13.0-Linux/bin/spades.py -o /gpfs0/scratch/shiming/trimmed_sequences/fastq/Assembly-Spades/CFC280618_metaspades --meta -t 16 -k 21,33,55,77 --pe1-1 ...
assembly written 3 months ago by Ming0 • updated 3 months ago by Sej Modha4.1k
2
votes
1
answer
161
views
6 follow
1
answer
(Closed) Appending strings to fasta header from another file
... Hello there, I have a A.fasta file containing: >AAL09996.1 ATGTCTAGCAAGCCGTCGAATATGCTTGATGAAGTTACCCTGTATACTCACTACGGCCTATCCGTGGCGAAGAAGCTCGGTGCGAATATGGTCGATGCTTTCCGGTCGGCCTTTTCGGTCAATGATGACATTCGTCAGGTGTATTACCGCGACAAGGGCATCTCTCACGCCAAAGCCGGTCGTTATTCCGAGGCAGTGGTGATGCTCGAGCAGGTTTACGATGCCGAT ...
fasta written 3 months ago by Ming0 • updated 3 months ago by jrj.healey11k
0
votes
1
answer
165
views
1
answers
Comment: C: Looking for degenerate primer sequences in a multi-fasta file
... Thank you! :) Much appreciated! ...
written 3 months ago by Ming0
0
votes
1
answer
165
views
1
answer
Looking for degenerate primer sequences in a multi-fasta file
... Hello there, Is there a certain software / script that you can recommend for looking for degenerate sequences in multi-fasta file? I know that primer-blast is one of them, but am just exploring other options. Thank You. ...
pcr written 4 months ago by Ming0 • updated 3 months ago by Cupton40

Latest awards to Ming

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1733 users visited in the last hour