User: Ming

gravatar for Ming
Ming0
Reputation:
0
Status:
New User
Last seen:
14 hours ago
Joined:
1 month, 4 weeks ago
Email:
s**************@hotmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by Ming

<prev • 11 results • page 1 of 2 • next >
0
votes
0
answers
41
views
0
answers
Warning when running PSI-BLAST
... Hello there, I am trying to looking for homologous genes using the PSI-BLAST function. 1.) I created a blast database of conserved genes that I had downloaded from uniprot makeblastdb -in mamA.AA.fasta -input_type fasta -dbtype prot -out mamA_db -parse_seqids 2.) I wanted to query my contigs - a ...
psi-blast written 2 days ago by Ming0
0
votes
0
answers
46
views
0
answers
Comment: C: Looking for homologous genes from contigs/scaffolds
... Dear @jrj.healey, Thanks for the reply and recommendation. Pan-genome ortholog clustering tool (PanOCT) does not seem to be used for metagenomics? ...
written 9 days ago by Ming0
0
votes
0
answers
46
views
0
answers
Looking for homologous genes from contigs/scaffolds
... Hello there, I am trying to pull out homologous genes from contigs/scaffolds that I have assembled from a metagenomics dataset. I have already constructed a fasta file of the gene family that I am interested in from Uniprot. I have read that performing PSI-BLAST with a low e-value can be used to pu ...
homologous genes written 9 days ago by Ming0
0
votes
1
answer
136
views
1
answers
Comment: C: Error during Spades Meta-assembly: err code: -9
... Thank you very much! ...
written 26 days ago by Ming0
0
votes
1
answer
125
views
1
answers
Comment: C: Appending strings to fasta header from another file
... Thank you very much for your help. :) ...
written 27 days ago by Ming0
2
votes
1
answer
136
views
1
answer
Error during Spades Meta-assembly: err code: -9
... Hello there, I was trying to run a meta-assembly on my Hi-Seq samples and I came across this error: Command line: /scratch/shiming/tools/SPAdes-3.13.0-Linux/bin/spades.py -o /gpfs0/scratch/shiming/trimmed_sequences/fastq/Assembly-Spades/CFC280618_metaspades --meta -t 16 -k 21,33,55,77 --pe1-1 ...
assembly written 27 days ago by Ming0 • updated 27 days ago by Sej Modha4.0k
2
votes
1
answer
125
views
6 follow
1
answer
(Closed) Appending strings to fasta header from another file
... Hello there, I have a A.fasta file containing: >AAL09996.1 ATGTCTAGCAAGCCGTCGAATATGCTTGATGAAGTTACCCTGTATACTCACTACGGCCTATCCGTGGCGAAGAAGCTCGGTGCGAATATGGTCGATGCTTTCCGGTCGGCCTTTTCGGTCAATGATGACATTCGTCAGGTGTATTACCGCGACAAGGGCATCTCTCACGCCAAAGCCGGTCGTTATTCCGAGGCAGTGGTGATGCTCGAGCAGGTTTACGATGCCGAT ...
fasta written 4 weeks ago by Ming0 • updated 4 weeks ago by jrj.healey9.8k
0
votes
1
answer
124
views
1
answers
Comment: C: Looking for degenerate primer sequences in a multi-fasta file
... Thank you! :) Much appreciated! ...
written 7 weeks ago by Ming0
0
votes
1
answer
124
views
1
answer
Looking for degenerate primer sequences in a multi-fasta file
... Hello there, Is there a certain software / script that you can recommend for looking for degenerate sequences in multi-fasta file? I know that primer-blast is one of them, but am just exploring other options. Thank You. ...
pcr written 8 weeks ago by Ming0 • updated 8 weeks ago by Cupton40
0
votes
1
answer
159
views
1
answers
Comment: C: How do I extract taxonomy/organism from NCBI .gb files?
... Thank you! Will try it! ...
written 8 weeks ago by Ming0

Latest awards to Ming

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1184 users visited in the last hour