User: szabo.marton

gravatar for szabo.marton
Reputation:
0
Status:
New User
Last seen:
16 hours ago
Joined:
1 week, 1 day ago
Email:
s***********@med.u-szeged.hu

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by szabo.marton

<prev • 7 results • page 1 of 1 • next >
0
votes
0
answers
80
views
0
answers
Comment: C: microRNA-seq sequence lenght distribution after trimming
... I checked the kit, we have used NEBNext Adaptors and Primers for Illumina (NEB #E7300), here are the ducomentation with the adapter sequences: https://international.neb.com/-/media/catalog/datacards-or-manuals/manuale7300_e7330_e7560_e7580.pdf#page=24 Anyway I'm still confused what sequence should ...
written 6 days ago by szabo.marton0
0
votes
0
answers
80
views
0
answers
Comment: C: microRNA-seq sequence lenght distribution after trimming
... Thanks your advice! I'll check about that for details. That would be nice if we had sequenced piRNAs as well, but in my case the read lenghts are only 36 nt, so I guess the chance for full or at least reliable piRNA sequences is very low. Also the lab guys performed a size selection for 24 nt before ...
written 7 days ago by szabo.marton0
0
votes
0
answers
80
views
0
answers
Comment: C: microRNA-seq sequence lenght distribution after trimming
... Thanks your answer! The read length was 36 nt. I was told to use Trimmomatic for discarding adapter sequences, because it contains the adapter sequences, however it did nothing (maybe I did something wrong). Therefore I searched for the TruSeq adapters and I found that adapter sequence. About the ...
written 7 days ago by szabo.marton0
8
votes
0
answers
80
views
0
answers
microRNA-seq sequence lenght distribution after trimming
... Hi! I'm doing a microRNA-seq analysis. After trimming and checking the results **in FastQC the sequence length distribution panel shows two peaks at 24 nt and 36 nt.** Here is my trimming command: `cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -e 0.1 -O 5 -o H28_trim_test3.fastq H28.fastq` after a ...
alignment rna-seq written 7 days ago by szabo.marton0
0
votes
0
answers
57
views
0
answers
Comment: C: mirdeep2 installation error
... Wow finally it's working! Thank you so much for you advice! ...
written 8 days ago by szabo.marton0
0
votes
0
answers
57
views
0
answers
Comment: C: mirdeep2 installation error
... Thanks your advice, I'm not familiar with conda, but I guess it's worth a try. ...
written 8 days ago by szabo.marton0
2
votes
0
answers
57
views
0
answers
mirdeep2 installation error
... Hi! I've tried to use mirdeep2 package to miRseq analysis on Ubuntu. However I have no previous experience with seq analysis nor using Ubuntu surface. I followed to instruction provided by the developers, but when I wanted to use the mapper.pl module the following error message came up: dirnam ...
software error written 8 days ago by szabo.marton0 • updated 8 days ago by h.mon22k

Latest awards to szabo.marton

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1246 users visited in the last hour