User: szabo.marton

gravatar for szabo.marton
Reputation:
0
Status:
New User
Last seen:
2 days, 1 hour ago
Joined:
10 months ago
Email:
s***********@med.u-szeged.hu

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by szabo.marton

<prev • 9 results • page 1 of 1 • next >
0
votes
0
answers
51
views
0
answers
Comment: C: Error while using hisat2 (hisat2-align exited with value 137)
... Thank you for your reply! Would it be that simple? I have only 4 Gb RAM, it is not to much but it was enough for previous analysis. I don't use any job scheduler, would it be useful? ...
written 2 days ago by szabo.marton0
1
vote
0
answers
51
views
0
answers
Error while using hisat2 (hisat2-align exited with value 137)
... Dear All, I've tried mapping my trimmed RNA-Seq reads against the indexed reference genome using hisat2 but I've got the following error message: Killed (ERR): hisat2-align exited with value 137 I coudn't find any answers related to this type of error. Here is the used command: hisat ...
alignment rna-seq written 4 days ago by szabo.marton0
0
votes
0
answers
271
views
0
answers
Comment: C: microRNA-seq sequence lenght distribution after trimming
... I checked the kit, we have used NEBNext Adaptors and Primers for Illumina (NEB #E7300), here are the ducomentation with the adapter sequences: https://international.neb.com/-/media/catalog/datacards-or-manuals/manuale7300_e7330_e7560_e7580.pdf#page=24 Anyway I'm still confused what sequence should ...
written 10 months ago by szabo.marton0
0
votes
0
answers
271
views
0
answers
Comment: C: microRNA-seq sequence lenght distribution after trimming
... Thanks your advice! I'll check about that for details. That would be nice if we had sequenced piRNAs as well, but in my case the read lenghts are only 36 nt, so I guess the chance for full or at least reliable piRNA sequences is very low. Also the lab guys performed a size selection for 24 nt before ...
written 10 months ago by szabo.marton0
0
votes
0
answers
271
views
0
answers
Comment: C: microRNA-seq sequence lenght distribution after trimming
... Thanks your answer! The read length was 36 nt. I was told to use Trimmomatic for discarding adapter sequences, because it contains the adapter sequences, however it did nothing (maybe I did something wrong). Therefore I searched for the TruSeq adapters and I found that adapter sequence. About the ...
written 10 months ago by szabo.marton0
8
votes
0
answers
271
views
0
answers
microRNA-seq sequence lenght distribution after trimming
... Hi! I'm doing a microRNA-seq analysis. After trimming and checking the results **in FastQC the sequence length distribution panel shows two peaks at 24 nt and 36 nt.** Here is my trimming command: `cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -e 0.1 -O 5 -o H28_trim_test3.fastq H28.fastq` after a ...
alignment rna-seq written 10 months ago by szabo.marton0
0
votes
0
answers
438
views
0
answers
Comment: C: mirdeep2 installation error
... Wow finally it's working! Thank you so much for you advice! ...
written 10 months ago by szabo.marton0
0
votes
0
answers
438
views
0
answers
Comment: C: mirdeep2 installation error
... Thanks your advice, I'm not familiar with conda, but I guess it's worth a try. ...
written 10 months ago by szabo.marton0
2
votes
0
answers
438
views
0
answers
mirdeep2 installation error
... Hi! I've tried to use mirdeep2 package to miRseq analysis on Ubuntu. However I have no previous experience with seq analysis nor using Ubuntu surface. I followed to instruction provided by the developers, but when I wanted to use the mapper.pl module the following error message came up: dirnam ...
software error written 10 months ago by szabo.marton0 • updated 10 months ago by h.mon28k

Latest awards to szabo.marton

Supporter 25 days ago, voted at least 25 times.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1457 users visited in the last hour