User: bioinfo2345

gravatar for bioinfo2345
Reputation:
0
Status:
New User
Last seen:
1 month ago
Joined:
1 month ago
Email:
b************@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by bioinfo2345

<prev • 3 results • page 1 of 1 • next >
0
votes
1
answer
178
views
1
answers
Comment: C: Why does bacterial codon table translate GTG start codon to V and not M?
... It appears to be directly submitted and translated with table 11, so perhaps the people who directly submitted it had fallen for the same problem that I had. They saw TTG and thought M, when it is really L. ...
written 4 weeks ago by bioinfo23450
0
votes
1
answer
178
views
1
answers
Comment: C: Why does bacterial codon table translate GTG start codon to V and not M?
... Thank you for your fast reply. It really helped to better understand the situation. Very nice paper you linked as well. So for clarification, this protein, for instance, is mistranslated? https://www.ncbi.nlm.nih.gov/nuccore/JQ396378.1?report=fasta (starts with TTG) https://www.ncbi.nlm.nih.gov/pr ...
written 5 weeks ago by bioinfo23450
4
votes
1
answer
178
views
1
answer
Why does bacterial codon table translate GTG start codon to V and not M?
... Consider the following sequence: >sequence GTGACCGGCAGCGCGGCCACGATCCGCCCGGCCAAGGCGGCCGATGCGGTCGCGTGGGCG CAGCTGCGTCTGGGCCTGTGGCCCGATGCCGATGATCCGCTGGAGACGCTGGTGGCGGCG CTGGCCGAGGACGCAGGTGCGGTTTTCCTGGCGTGTGCAGCGGGTGGCCAGGCGATCGGC TTCGCCGAAGTGCGCCTGCGCCATGACTACGT In this bacteria ...
valine bacterial codon bacterial code gtg written 5 weeks ago by bioinfo23450

Latest awards to bioinfo2345

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 832 users visited in the last hour