User: bioinfo2345

gravatar for bioinfo2345
bioinfo234520
Reputation:
20
Status:
New User
Location:
Last seen:
4 months, 2 weeks ago
Joined:
9 months, 1 week ago
Email:
b************@gmail.com

Posts by bioinfo2345

<prev • 10 results • page 1 of 1 • next >
0
votes
2
answers
276
views
2
answers
Comment: C: What does it mean if a gene is not found in an assembly?
... It is a good idea but unfortunately genome sizes varies substantially within species' of interest. It is also still an evidence of absence argument. Do you think synteny could be robustly used to estimate gene absence? Assuming that the order of genes are: gene A - gene B - gene C then is finding ...
written 6 months ago by bioinfo234520
0
votes
2
answers
276
views
2
answers
Comment: C: What does it mean if a gene is not found in an assembly?
... In this scenario, transcriptome data is not available and there is no chance of it every being available for many, many years and low homology never happens / is never relevant. Your suggestion also does not address the issue of if absence of evidence is evidence of absence. It is merely an assembl ...
written 6 months ago by bioinfo234520
0
votes
2
answers
276
views
2
answers
Comment: C: What does it mean if a gene is not found in an assembly?
... I am sure you are aware that there are many experimental papers out there that are based on errors in the lab of various kinds and there are many steps that can go wrong or be incompletely carried out. ...
written 6 months ago by bioinfo234520
0
votes
2
answers
276
views
2
answers
Comment: C: What does it mean if a gene is not found in an assembly?
... 1. PCR can handle the absence of evidence problem by also running the sample with other primers in such a way that you will get another predictable product if the gene is missing. 2. There are many cases where you would like to identify thousands of genes per sample in a rapid and high-throughput w ...
written 6 months ago by bioinfo234520
0
votes
2
answers
276
views
2
answers
Comment: C: What does it mean if a gene is not found in an assembly?
... The scenario that I outlined was that due to a low complexity library, you only have, let us for the sake of argument say half of the genome that you have sequenced over and over (approximately twice the depth). Your N50 would be large (good coverage), you would have few contigs and high coverage. ...
written 6 months ago by bioinfo234520
0
votes
2
answers
276
views
2
answers
Comment: C: What does it mean if a gene is not found in an assembly?
... This is disproved by cases where you have e. g. low complexity library. Entirely possible to have high coverage, few contigs and high N50, but still missing a considerable part of the genome. Just switching assembler could also change the gene content by hundreds of protein-encoding genes, albeit a ...
written 6 months ago by bioinfo234520
0
votes
2
answers
276
views
2
answers
What does it mean if a gene is not found in an assembly?
... I have two questions: 1) Can you reliably and robustly predict the absence of a gene (either missing entirely or being non-functional) from an organism simply by not finding it in an assembly based on whole genome sequencing from a bacterial cell culture taken from clinical samples? 2) If no, is t ...
assembly gene identification written 6 months ago by bioinfo234520 • updated 6 months ago by Carambakaracho1.9k
0
votes
3
answers
1.7k
views
3
answers
Comment: C: Why does bacterial codon table translate GTG start codon to V and not M?
... It appears to be directly submitted and translated with table 11, so perhaps the people who directly submitted it had fallen for the same problem that I had. They saw TTG and thought M, when it is really L. ...
written 9 months ago by bioinfo234520
0
votes
3
answers
1.7k
views
3
answers
Comment: C: Why does bacterial codon table translate GTG start codon to V and not M?
... Thank you for your fast reply. It really helped to better understand the situation. Very nice paper you linked as well. So for clarification, this protein, for instance, is mistranslated? https://www.ncbi.nlm.nih.gov/nuccore/JQ396378.1?report=fasta (starts with TTG) https://www.ncbi.nlm.nih.gov/pr ...
written 9 months ago by bioinfo234520
15
votes
3
answers
1.7k
views
7 follow
3
answers
Why does bacterial codon table translate GTG start codon to V and not M?
... Consider the following sequence: >sequence GTGACCGGCAGCGCGGCCACGATCCGCCCGGCCAAGGCGGCCGATGCGGTCGCGTGGGCG CAGCTGCGTCTGGGCCTGTGGCCCGATGCCGATGATCCGCTGGAGACGCTGGTGGCGGCG CTGGCCGAGGACGCAGGTGCGGTTTTCCTGGCGTGTGCAGCGGGTGGCCAGGCGATCGGC TTCGCCGAAGTGCGCCTGCGCCATGACTACGT In this bacteria ...
valine bacterial codon bacterial code gtg written 9 months ago by bioinfo234520 • updated 8 weeks ago by Juke-342.9k

Latest awards to bioinfo2345

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1312 users visited in the last hour