User: kristopherfernandez

Reputation:
10
Status:
New User
Location:
Last seen:
1 year, 9 months ago
Joined:
1 year, 11 months ago
Email:
k******************@outlook.com

Posts by kristopherfernandez

<prev • 6 results • page 1 of 1 • next >
0
votes
0
answers
327
views
0
answers
Lattice vs Lattice-Free Models?
... I am a bioinformatics student and I'm learning about cellular models. I'm don't understand the important differences between "Lattice" cellular models versus "Lattice-free" cellular models. What are the differences and what makes one better than the other? Advantages / disadvantages? Thank you so m ...
software models cell cellular written 21 months ago by kristopherfernandez10
0
votes
1
answer
501
views
1
answers
Comment: C: How to pivot pandas dataframe?
... Once you have this object, how can you subset / filter to find, say, all samples with SNP1 'AA'? ...
written 22 months ago by kristopherfernandez10
4
votes
1
answer
501
views
1
answer
How to pivot pandas dataframe?
... Given a dataframe: Sample_Name SNP1 SNP2 SNP3 Sample 1 AA AC GC Sample 2 GA AC CG Sample 3 AA AA GG How do I get: Sample_Name SNP Value Sample 1 SNP1 AA Sample 1 SNP2 AC Sample 1 SNP3 GC Sample 2 SNP1 GA Sample 2 SNP2 AC Sample 2 SNP3 C ...
python pandas dataframe pivot written 22 months ago by kristopherfernandez10
0
votes
0
answers
587
views
0
answers
How to make combinations of genotypes given an allele dataframe?
... Given a pandas data frame where (I'm new to this so I'm not even sure how to represent this here): Name SNP1 SNP2 SNP3 SNP4 Allele1 A C T G Allele2 C T G A Allele3 C G A A How do I create all the combinations of alleles (possible genotypes): Allele1/Allele1, Allele1/Allele2, A ...
python pandas dataframe matrix written 22 months ago by kristopherfernandez10
0
votes
2
answers
1.1k
views
2
answers
Comment: C: In R or Python, How do I implement an allele sequence "autocomplete" tool given
... Amazing! I am new to computer programming and learning these things really help me add new skills to my toolbox. So for that, thank you! ...
written 23 months ago by kristopherfernandez10
5
votes
2
answers
1.1k
views
2
answers
In R or Python, How do I implement an allele sequence "autocomplete" tool given a dictionary of possible allele sequence matches?
... In R or Python, how do I implement an allele sequence "autocomplete" tool given a dictionary of possible allele sequence matches? That is, given, say an allele sequence: CC_ATCGATCGTA_GATCGGCAA_GTGA And given a limited number of dictionary values: Allele 1: CCGATCGATCGTACGATCGGCAAGGTGA ...
R sequencing snp assembly python written 23 months ago by kristopherfernandez10 • updated 23 months ago by zx875410.0k

Latest awards to kristopherfernandez

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1564 users visited in the last hour
_