User: drragill

gravatar for drragill
drragill10
Reputation:
10
Status:
New User
Location:
Last seen:
3 weeks, 2 days ago
Joined:
7 months, 1 week ago
Email:
d*******@caas.cn

Posts by drragill

<prev • 15 results • page 1 of 2 • next >
0
votes
0
answers
150
views
0
answers
Comment: A: how to use Ka/Ks calculator
... Dear h.mon and Dave Carlson, Many thanks for your kind reply. But I encounter a problem as...Original Sequence has unconventional nucleotides. My input sequence (both) was in fasta format as below... ATGAAAGGCACGTTATCACCCGCTCTAGGGAACCTCGGATCTCTCCAGGTTTTGTTCATT TCTGGAACCAAGTTCATTGCCGGCTCGATTCCCAAC ...
written 7 weeks ago by drragill10
4
votes
0
answers
150
views
0
answers
how to use Ka/Ks calculator
... Hi, I want to calculate the divergence time of genes. Can somebody guide me on how to use the KaKs calculator software? Many thanks! ...
gene alignment rna-seq written 7 weeks ago by drragill10 • updated 5 weeks ago by Biostar ♦♦ 20
5
votes
1
answer
208
views
1
answer
How to do the WGCNA in R
... Hi all, Please guide me to perform the WGCNA in R as I have 321 accessions (from plants) with expression values. I already installed the WGCNA, Fastcluster and DynamicTreecut in R. ...
R rna-seq written 4 months ago by drragill10 • updated 4 months ago by finswimmer13k
0
votes
0
answers
155
views
0
answers
SNP target traits common in two tissues
... Hi, I used two tissues in Plants and perform Illumina sequencing for RNA (and for comparison did DNA too) and then calculate the SNPs targetting different traits using GWAS. Interestingly several traits are common in two tissues that supposed not to be. How I can answer this question in the Articl ...
rna-seq snp written 5 months ago by drragill10 • updated 4 months ago by Biostar ♦♦ 20
1
vote
1
answer
214
views
1
answers
Comment: C: SNPs from RNA-Seq Compare with SNPs from DNA-Seq
... Dear Charles Warden, Many thanks for your kind contribution and Suggestions! ...
written 5 months ago by drragill10
0
votes
1
answer
214
views
1
answers
Comment: C: SNPs from RNA-Seq Compare with SNPs from DNA-Seq
... Dear Shawn, Many thanks for your kind suggestions/guidance, here my purpose is to do the GWAS using SNPs as genotypes and plant phenotypic treats (5 yrs) as a Phenotype. So, you can say it is GAWS analysis GBP (genotype by phenotype). These SNPs I called using the GATK pipeline from RNA-Seq data. ...
written 5 months ago by drragill10
3
votes
1
answer
214
views
1
answer
SNPs from RNA-Seq Compare with SNPs from DNA-Seq
... Hi, I have two questions... 1. I wanted to compare the SNPs variation due to transcription. So, I called SNPs from RNA-Seq of 321 samples of two different tissues. Please guide me which software I need to use and which pipeline needs to follow to know the variations due to transcription compare th ...
genome assembly alignment rna-seq written 5 months ago by drragill10 • updated 5 months ago by shawn.w.foley1.1k
0
votes
1
answer
183
views
1
answers
Comment: C: Can detection of SNP from DNA (Intronic part) and mRNA (Exonic Part) make some
... Dear Shawn, Many thanks for your reply and it really improved my knowledge regarding this area. ...
written 6 months ago by drragill10
0
votes
1
answer
183
views
1
answer
Can detection of SNP from DNA (Intronic part) and mRNA (Exonic Part) make some real differences?
... In my understanding information regarding the gene expression come from mRNA (exon) and control or regulation of a gene can get from non-coding part of DNA (intron etc.). If it is true then I have a hypothesis that SNPs from mRNA (Exonic part) can provide the information related to a trait (through ...
genome snp rna-seq written 6 months ago by drragill10 • updated 6 months ago by shawn.w.foley1.1k
0
votes
2
answers
231
views
2
answers
Comment: C: Learning analysis of RNA-Seq data from assembly to final publishable
... Many thanks for your kind suggestions! ...
written 7 months ago by drragill10

Latest awards to drragill

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1802 users visited in the last hour