User: kihugaharrison

New User
Last seen:
1 year, 5 months ago
1 year, 5 months ago

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by kihugaharrison

<prev • 2 results • page 1 of 1 • next >
Comment: C: Plasmodium falciparum SNPS analysis
... Dear Kevin, I have raw whole genome sequences 150 bases long that look like this.... family_nr:-300:family_nt:1639119:genus_nr:-200:genus_nt:5820:species_nr:-100:species_nt:5821:NR::NT:LK023122.1:ST-E00493:300:HFKVJCCXY:6:1217:4584:64632/1 TCATGAAATACAACCATAAAATTGAGTTTTAGGTCCAAAATTCCTTACCT ...
written 17 months ago by kihugaharrison0 • updated 17 months ago by Kevin Blighe67k
Plasmodium falciparum SNPS analysis
... I have 29 plasmodium falciparum whole genome sequences that i need to analyse for SNPs. The problem is, each sample contains multiple sequences of upto 768,000 neucleotides....i need to convert this into a single sequence. How do i do this? ...
genome written 17 months ago by kihugaharrison0

Latest awards to kihugaharrison

No awards yet. Soon to come :-)


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1636 users visited in the last hour