User: LAB_2019

gravatar for LAB_2019
LAB_20190
Reputation:
0
Status:
New User
Last seen:
12 hours ago
Joined:
6 days, 20 hours ago
Email:
j*******@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by LAB_2019

<prev • 5 results • page 1 of 1 • next >
0
votes
0
answers
150
views
0
answers
Comment: C: No aligned reads after featurecounts. BAM files have >85% reads mapped
... Thanks for your help. I think I accomplished what I needed to do with your suggestions. Here is what I did: 1. Mapped reads w/ HISAT2 to transcripts.fa 2. Performed idxStats on .BAM files to count #mapped reads 3. Constructed raw counts file and performed differential gene expression analysis The ...
written 3 days ago by LAB_20190
0
votes
0
answers
150
views
0
answers
Comment: C: No aligned reads after featurecounts. BAM files have >85% reads mapped
... I simplified this. I re-ran HISAT2 with my paired-end fastq files and only the transcripts.fa file as a reference. here is the format of the transcripts.fa >Niben101Scf03546g00006.1 TTTTTAAATATTAAATTCATAAAATTTAGA This produced the .BAM file. Here is a sample for idxStats (had ~65% mappe ...
written 5 days ago by LAB_20190
0
votes
0
answers
150
views
0
answers
Comment: C: No aligned reads after featurecounts. BAM files have >85% reads mapped
... Thanks for the advice. I am going to re-align one test sample using only 1 .fa file. I will double check the Genome.fa and transcripts.fa to make sure they have the same ID's as my .GFF file. I am mainly trying to differential gene expression analysis. Would you recommend using only the transcripts. ...
written 6 days ago by LAB_20190
0
votes
0
answers
150
views
0
answers
Comment: C: No aligned reads after featurecounts. BAM files have >85% reads mapped
... The BAM files were generated using a "contigs" .fasta and a "transcripts" .fasta. The transcript format wasx as such: Niben101_annotation.transcripts.fasta >Niben101Scf03546g00006.1 TTTTTAAATATTAAATTCATAAAATTTAGACCTGG Is there a way to edit the BAM or .GFF files to create uniformity ...
written 6 days ago by LAB_20190
2
votes
0
answers
150
views
0
answers
No aligned reads after featurecounts. BAM files have >85% reads mapped
... Hello, new to RNA-seq here. I have mapped my fastq reads to a reference genome (transcript.fasta) with HISAT2. The BAM files look very good with >85% reads mapped. However, when I try to use featurecounts, both local and on Galaxy, the results always yield 0 mapped reads. From lurking around the ...
rna-seq written 6 days ago by LAB_20190 • updated 6 days ago by lieven.sterck5.2k

Latest awards to LAB_2019

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1929 users visited in the last hour