User: rebelCoder

gravatar for rebelCoder
rebelCoder10
Reputation:
10
Status:
New User
Location:
Riga/London/Moscow/Minneapolis
Website:
https://rebelscience.c...
Twitter:
rebelCoderRU
Last seen:
1 month, 3 weeks ago
Joined:
11 months, 3 weeks ago
Email:
j*****@pm.me

Programmer. For life extension! Into Brain & Consciousness studies. Robotics/A.I. engineering for Space travel. Vegan. 100% FOSS. Transferring my programming skills into Bioinformatics.

Web: https://rebelscience.club/
YouTube: Bioinfromatics
Bio Telegram: https://t.me/biocodex
Bio Matrix: biotechdna

Posts by rebelCoder

<prev • 7 results • page 1 of 1 • next >
0
votes
0
answers
166
views
0
answers
Comment: A: Multiple START codons in DNA/RNA Translation
... I think I found a good answer here: > It's common to have multiple ATG codons in an mRNA sequence. > Generally, the first ATG serves as protein translation starting site > and is considered as a start codon if that ATG is at the beginning of > a full and functional open reading frame. T ...
written 8 weeks ago by rebelCoder10
0
votes
0
answers
166
views
0
answers
Comment: C: Multiple START codons in DNA/RNA Translation
... Oh. It is not a problem at all. I understand the process and I have my code working just fine. All I am asking, is, are those, multiple START codon sequences useful and do we have any real proteins that have double or more START codons in them? It does not look like there are? So it is not as proble ...
written 8 weeks ago by rebelCoder10
1
vote
0
answers
166
views
0
answers
Multiple START codons in DNA/RNA Translation
... Hello! If we apply a basic algorithm to a reading frame to scan it and look for START and STOP codons (to assemble a possible protein), we get cases, when we have multiple START codons and one STOP codon: Example: Reading Frame: `['A', 'S', 'M', 'A', 'P', 'M', 'Q', 'P', 'I', 'T', 'P', 'S', 'A', ...
codons translation rna dna written 8 weeks ago by rebelCoder10 • updated 13 days ago by Biostar ♦♦ 20
0
votes
1
answer
690
views
1
answers
Comment: A: DNA Codon Table vs RNA Codon Table?
... May I ask a related question? `Open Reading Frames`: I create 6 reading frames from a `DNA` string and search for `START` - `STOP` codons (standard/simple stuff), but I am confused with one point: when/why/if we should use a `DNA/Reverse Complement` to create 6 reading frames to search in, or shoul ...
written 4 months ago by rebelCoder10
4
votes
1
answer
690
views
1
answer
DNA Codon Table vs RNA Codon Table?
... Hello smart people! What is the point of `DNA Codons` (`DNA Codon Table`) ? ![enter image description here][1] Don't we do `DNA` --> `RNA` `Transcription` to generate `mRNA` and use `RNA Codon Table` to do a `Translation` in order to generate a sequence of `Amino acids`? ![enter image descrip ...
gene written 4 months ago by rebelCoder10
1
vote
1
answer
274
views
1
answers
Answer: A: Looking for a DNA -> Protein Sample/Example.
... I got some help from IRC, so this is no longer a problem: Insulin DNA Sequence: ![enter image description here][1] Protein Sequence: ![enter image description here][2] [1]: https://i.imgur.com/FscJRYq.png [2]: https://i.imgur.com/0BVBqBU.png ...
written 8 months ago by rebelCoder10
1
vote
1
answer
274
views
1
answer
Looking for a DNA -> Protein Sample/Example.
... Hello everyone! I am looking for a real example of a DNA sequence that codes for a real (any) protein. the shorter, the better. I have the following Fake/Randomly Generated sequence: `"AAAGAACATGACTCCAATTTCGGAACCAAGTAGTTAAATCCTGTGA"` And it has the following Fake/Not Real/Test protein sequence: ...
sequence protein dna written 8 months ago by rebelCoder10

Latest awards to rebelCoder

Scholar 4 months ago, created an answer that has been accepted. For A: Looking for a DNA -> Protein Sample/Example.
Autobiographer 11 months ago, has more than 80 characters in the information field of the user's profile.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1347 users visited in the last hour