User: Rashedul Islam

gravatar for Rashedul Islam
Scholar ID:
Google Scholar Page
Last seen:
3 days, 19 hours ago
4 years, 9 months ago

I am a Bioinformatics PhD student.

Posts by Rashedul Islam

<prev • 18 results • page 1 of 2 • next >
Answer: A: Find the highest value in an interval defined in an other file
... For this purpose you can use [bedtools groupby][1] and -o max option to get the maximum value. [1]: ...
written 3 days ago by Rashedul Islam120
Answer: A: Peak calling for broad histone-modification regions
... Hi, if you expect peaks of 10-100kb width, you can merge nearby narrow peaks using beedtools merge -d option. I found another peak caller [FindER][1] that allows controlling the peak width with -minSize (minimum size of peak), -maxGap (maximum size of peak) parameters. [1]: http://www.epigenome ...
written 5 days ago by Rashedul Islam120
Answer: A: coverage for unique transcript and df process
... You might be looking for this, if not please add reproducible input and output. Thanks! library(dplyr) df = data.frame(x = c("a","b","b"), y = c(1:3)) df %>% group_by(x) %>% summarise(y = sum(y)) ...
written 5 days ago by Rashedul Islam120
Comment: C: Is rs# of an SNP comparable between genome version or build?
... Thanks @Brain for the comment. I also found relevant information in NCBI documentation [here][1] that "Depending on the organism, the net result of the alterations in assemblies and annotations mentioned above is that a SNP may be in an exon (or more generally, located in a gene) in one build, but ...
written 5 days ago by Rashedul Islam120
Is rs# of an SNP comparable between genome version or build?
... Hi All, I am working on public genotype data in [opensnp][1]. I found that different platform (e.g., 23andme, decodeme etc) uses different genome versions (e.g., GRCh37 or GRCh36) and therefore, I have found different chromosomal position for the same reference SNP (rs#) id. For few SNP ids, I chec ...
snp written 5 days ago by Rashedul Islam120
Comment: C: Bam File: Change Chromosome Notation
... Perfectly worked for me. Thanks @Pierre Lindenbaum and @petervangalen ...
written 16 days ago by Rashedul Islam120
Answer: A: Quickest Way To Get Human Gene Symbols From Refseq Build 37
... You can get this from [UCSC table browser][1]. Select genome version and RefSeq genes for the track. This will give you a table with RefSeq id and gene names. [1]: ...
written 6 months ago by Rashedul Islam120
Answer: C: Linux for loop for 2 inputs and 4 outputs for Trimmomatic fastq quality trimming
... Finally, I used this code to run Trimmomatic in a loop in linux. for file in /path/to/*_R1.fastq do withpath="${file}" filename=${withpath##*/} base="${filename%*_*.fastq}" echo "${base}" java -jar trimmomatic-0.33.jar PE /path/to/"${base}"*_R1.fastq /path/to/"${base}"*_R2.fastq /path/to/"${base}"_ ...
written 21 months ago by Rashedul Islam120 • updated 21 months ago by Michael Dondrup41k
Comment: C: Matching gene id and extracting fasta sequences using shell script
... Thank you for your reply. Your answer helped. I found this link: ...
written 23 months ago by Rashedul Islam120
Matching gene id and extracting fasta sequences using shell script
... Dear All, I have a list of genes id e.g. gene01 gene22 gene27 and so on. I need extract the gene names with fasta sequence from assembly fie. Assembly file looks: >gene01 ATAGCGATCCCCCTTTTTCCTT >gene02 ATACCCCCGCGAT >gene03 ATACCCAAAAAAACCGCGAT and so on. Can anyone help me to w ...
fasta shell written 23 months ago by Rashedul Islam120 • updated 23 months ago by Matt Shirley7.2k

Latest awards to Rashedul Islam

Great Question 12 weeks ago, created a question with more than 5,000 views. For Cufflinks error: BAM record error: found spliced alignment without XS attribute
Teacher 3 months ago, created an answer with at least 3 up-votes. For C: Linux for loop for 2 inputs and 4 outputs for Trimmomatic fastq quality trimming
Epic Question 8 months ago, created a question with more than 10,000 views. For Drawing venn diagram in R
Student 10 months ago, asked a question with at least 3 up-votes. For Drawing venn diagram in R
Great Question 14 months ago, created a question with more than 5,000 views. For Drawing venn diagram in R
Popular Question 14 months ago, created a question with more than 1,000 views. For Drawing venn diagram in R
Popular Question 21 months ago, created a question with more than 1,000 views. For Drawing venn diagram in R
Popular Question 2.5 years ago, created a question with more than 1,000 views. For Cufflinks error: BAM record error: found spliced alignment without XS attribute


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 955 users visited in the last hour