User: The Terminator

Reputation:
10
Status:
New User
Location:
Last seen:
1 month ago
Joined:
1 month, 1 week ago
Email:
t*************@gmail.com

Posts by The Terminator

<prev • 4 results • page 1 of 1 • next >
0
votes
0
answers
67
views
0
answers
How to interprete PlasmidSeeker results when you have some plasmid clusters?
... I've been interested in plasmid detection in bacterial genomes. I tried plasmidfinder and this software found only one plasmid in each of my two bacterial genomes. I was dubious about these results, because I read many genome announcements which found something like from 6 to 10 plasmids per genome ...
perl plasmid software usage result written 5 weeks ago by The Terminator10 • updated 3 days ago by Biostar ♦♦ 20
0
votes
0
answers
106
views
0
answers
How to interprete PlasmidSeeker results when you have some plasmid clusters?
... Hi all, I've been interested in plasmid detection in bacterial genomes. I tried [plasmidfinder][1] and this software found only one plasmid in each of my two bacterial genomes. I am dubious about these results, because I read many genome announcements which found something like from 6 to 10 plasmid ...
genome annotation bacteria written 5 weeks ago by The Terminator10
0
votes
0
answers
112
views
0
answers
Comment: C: Phaster.py script error
... $ head Th19.fna > gnl|MG|TH19_1 ATTTTGTACATGCTTAAACAAGCGAAAATGTACATGTTTATCTTGACATTTACAGAGTTA CTCATTTTTCTATCACTCCTTTCATTTCGTCCTAATTACTATAACCATTTAGGAGGATAA TCATGAGTTAGAAGTTAGGCACTTAATTTTCTTCGATAATGTAAGTAAAATATTCCATAC ATAACAAATAGCATGAGTAAAACTTGTAACTCTACATTTTCCTTTAAAATAGCTGCGA ...
written 5 weeks ago by The Terminator10 • updated 5 weeks ago by Devon Ryan91k
1
vote
0
answers
112
views
0
answers
Phaster.py script error
... Hi all, After cloning from GitHub, I tried to run Phaster.py (the Python script of PHASTER tool), I tried to run the script by using this command: ./phaster.py --contigs --fasta path/to/genome.fasta The error was > 2019-07-11 14:32:02,389 INFO: Submission of TH19.fna appears successful ...
phaster python written 5 weeks ago by The Terminator10

Latest awards to The Terminator

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1646 users visited in the last hour