User: putita.jira

gravatar for putita.jira
putita.jira10
Reputation:
10
Status:
New User
Location:
Last seen:
3 weeks, 6 days ago
Joined:
1 month, 2 weeks ago
Email:
p**********@gmail.com

Posts by putita.jira

<prev • 9 results • page 1 of 1 • next >
0
votes
1
answer
143
views
1
answers
Comment: C: SSR mining and primer design (MISA and Primer3)
... Thank you so much h.mon for helping me. I replaced space with underscore in config file and it worked well! I ran the syntax until the last one which supposes to generate primer results in tabular format. p3_out.pl FASTA.fa.p3out FASTA.fa.misa but it was error. I found [here][1] that it has ...
written 27 days ago by putita.jira10
0
votes
1
answer
128
views
1
answers
Comment: C: Primer3: p3in failure
... Sorry h.mon. At that time, I was afraid that no one would read comment in the previous post and found that I have new problem so I decided to post new question here. Btw, I don't know how to delete this post. Thank you for your effort. I will never post the same question again. ...
written 28 days ago by putita.jira10
1
vote
1
answer
128
views
1
answer
Primer3: p3in failure
... Dear all I'm using MISA and Primer3 in pipeline. After I got *.misa file, I put this syntax. p3_in.pl FASTA.fa.misa Then I got empty file of *.p3in. Is it normal? By the way, I still tried to run further syntax. primer3_core < FASTA.fa.p3in > FASTA.fa.p3out This one showed me the ...
misa p3in primer3 written 28 days ago by putita.jira10 • updated 28 days ago by h.mon27k
0
votes
1
answer
143
views
1
answers
Comment: C: SSR mining and primer design (MISA and Primer3)
... In .misa file, no. It looks like this. ID SSR nr. SSR type SSR size start end 1_302_5934 1 p3 (TAT)7 21 1 21 1_302_5934 2 p3 (ATT)23 69 234 302 9_78_1277 1 c (TAA)5c(AAT)9aac(AAT)10 76 1 76 12_247_3182 1 c (CATC)16tattcatccattcatacatctatccatctatccacccg(TCCA)7 130 1 130 13_23 ...
written 28 days ago by putita.jira10
0
votes
1
answer
143
views
1
answers
Comment: C: SSR mining and primer design (MISA and Primer3)
... Thank you h.mon I really forgot to change gff setting in misa.ini file because I intended to use all default mining settings. Now I have a .misa file and I run this syntax p3_in.pl FASTA.fa.misa But I got an empty .p3in file. Could you help me figure out what might be wrong? ...
written 28 days ago by putita.jira10
0
votes
1
answer
211
views
1
answers
Comment: C: Why can't I perform large genome assembly by Velvet and ABySS?
... Thank you Daniel Swan Now I run it successfully with more RAM :) ...
written 29 days ago by putita.jira10
1
vote
1
answer
211
views
1
answers
Comment: C: Why can't I perform large genome assembly by Velvet and ABySS?
... I increased RAM and it works! Thank you ATpoint and Kevin Blighe for your suggestion :) ...
written 29 days ago by putita.jira10
2
votes
1
answer
143
views
1
answer
SSR mining and primer design (MISA and Primer3)
... Hi everyone! I'm trying to mine SSR from my assembled sequences and design primer pairs for them. I used MISA for SSR mining. As the manual stated, I supposed to get 2 output files: in .misa format and .statistics format. However, what I got are a .statistics file and more than 100,000 .gff files ...
ssr misa primer design primer3 microsatellite written 29 days ago by putita.jira10 • updated 29 days ago by h.mon27k
5
votes
1
answer
211
views
1
answer
Why can't I perform large genome assembly by Velvet and ABySS?
... Hi everyone! I'm new in bioinformatics field and I have some problems with de novo assembly. So I would like to ask for suggestions. General information about my work are... - Illumina paired-end, read length 150 bp - whole genome sequencing (estimate genome size is 224 million bp) - 100x cover ...
software error assembly genome written 6 weeks ago by putita.jira10 • updated 6 weeks ago by Daniel Swan13k

Latest awards to putita.jira

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1561 users visited in the last hour