User: putita.jira

gravatar for putita.jira
New User
Last seen:
11 months, 3 weeks ago
1 year ago

Posts by putita.jira

<prev • 9 results • page 1 of 1 • next >
Comment: C: SSR mining and primer design (MISA and Primer3)
... Thank you so much h.mon for helping me. I replaced space with underscore in config file and it worked well! I ran the syntax until the last one which supposes to generate primer results in tabular format. FASTA.fa.p3out FASTA.fa.misa but it was error. I found [here][1] that it has ...
written 11 months ago by putita.jira10
Comment: C: Primer3: p3in failure
... Sorry h.mon. At that time, I was afraid that no one would read comment in the previous post and found that I have new problem so I decided to post new question here. Btw, I don't know how to delete this post. Thank you for your effort. I will never post the same question again. ...
written 11 months ago by putita.jira10
Primer3: p3in failure
... Dear all I'm using MISA and Primer3 in pipeline. After I got *.misa file, I put this syntax. FASTA.fa.misa Then I got empty file of *.p3in. Is it normal? By the way, I still tried to run further syntax. primer3_core < FASTA.fa.p3in > FASTA.fa.p3out This one showed me the ...
misa p3in primer3 written 11 months ago by putita.jira10 • updated 11 months ago by h.mon30k
Comment: C: SSR mining and primer design (MISA and Primer3)
... In .misa file, no. It looks like this. ID SSR nr. SSR type SSR size start end 1_302_5934 1 p3 (TAT)7 21 1 21 1_302_5934 2 p3 (ATT)23 69 234 302 9_78_1277 1 c (TAA)5c(AAT)9aac(AAT)10 76 1 76 12_247_3182 1 c (CATC)16tattcatccattcatacatctatccatctatccacccg(TCCA)7 130 1 130 13_23 ...
written 11 months ago by putita.jira10
Comment: C: SSR mining and primer design (MISA and Primer3)
... Thank you h.mon I really forgot to change gff setting in misa.ini file because I intended to use all default mining settings. Now I have a .misa file and I run this syntax FASTA.fa.misa But I got an empty .p3in file. Could you help me figure out what might be wrong? ...
written 11 months ago by putita.jira10
Comment: C: Why can't I perform large genome assembly by Velvet and ABySS?
... Thank you Daniel Swan Now I run it successfully with more RAM :) ...
written 11 months ago by putita.jira10
Comment: C: Why can't I perform large genome assembly by Velvet and ABySS?
... I increased RAM and it works! Thank you ATpoint and Kevin Blighe for your suggestion :) ...
written 11 months ago by putita.jira10
SSR mining and primer design (MISA and Primer3)
... Hi everyone! I'm trying to mine SSR from my assembled sequences and design primer pairs for them. I used MISA for SSR mining. As the manual stated, I supposed to get 2 output files: in .misa format and .statistics format. However, what I got are a .statistics file and more than 100,000 .gff files ...
ssr misa primer design primer3 microsatellite written 11 months ago by putita.jira10 • updated 11 months ago by h.mon30k
5 follow
Why can't I perform large genome assembly by Velvet and ABySS?
... Hi everyone! I'm new in bioinformatics field and I have some problems with de novo assembly. So I would like to ask for suggestions. General information about my work are... - Illumina paired-end, read length 150 bp - whole genome sequencing (estimate genome size is 224 million bp) - 100x cover ...
software error assembly genome written 12 months ago by putita.jira10 • updated 12 months ago by Daniel Swan13k

Latest awards to putita.jira

No awards yet. Soon to come :-)


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 674 users visited in the last hour