User: adhirajnath14

gravatar for adhirajnath14
Reputation:
20
Status:
New User
Location:
Last seen:
1 month, 3 weeks ago
Joined:
8 months ago
Email:
a************@gmail.com

Posts by adhirajnath14

<prev • 16 results • page 1 of 2 • next >
0
votes
0
answers
128
views
0
answers
Comment: C: Problem in QIIME: Cannot run OTU picking script.
... I am not sure if I'm missing anything. I have seen people following the same protocol and get the analysis done. ...
written 3 months ago by adhirajnath1420
0
votes
0
answers
128
views
0
answers
Problem in QIIME: Cannot run OTU picking script.
... I am working with metagenomic data where I have already joined the forward & reverse pairs and converted them to .fna format using QIIME scripts. As the next step is to pick OTUs, I'm trying to execute: pick_open_reference_otus.py -i input.fna -o otu_out/ However while running the script, ...
software error python metagenomics qiime written 3 months ago by adhirajnath1420 • updated 6 weeks ago by Biostar ♦♦ 20
0
votes
2
answers
274
views
2
answers
Comment: C: Calculating Shannon entropy for RNA sequences in multi-fasta using rnaentropy
... Thank you so much, Sir. You are a real life saver. ...
written 5 months ago by adhirajnath1420
0
votes
2
answers
274
views
2
answers
Comment: C: Calculating Shannon entropy for RNA sequences in multi-fasta using rnaentropy
... The program is not taking any file as input. I ran a pseudo code and got this result: ./RNAentropy -s AAGCGCGCGTGACTGCAT 2.562930 0.699157 18 -0.880430 Sorry I couldn't follow how to split fasta as you suggested, which would make the input a series of string for each sequence. S ...
written 5 months ago by adhirajnath1420
13
votes
2
answers
274
views
5 follow
2
answers
Calculating Shannon entropy for RNA sequences in multi-fasta using rnaentropy
... I have to calculate the Shannon entropy for a given list of sequences in a fasta file. Recently I came across a program called rnaentropy which solves my problem but the issue is I cannot run sequences in batch. In the documentation the input is given as a sequence of strings. The parameters in the ...
rnaentropy sequence rna written 5 months ago by adhirajnath1420 • updated 5 months ago by ole.tange3.7k
2
votes
1
answer
253
views
1
answer
Is there a way to get RNAFold output for multifasta in tabular format?
... I am trying to calculate the MFE along with the secondary structure for multifasta using RNAFold. The output generated is of the format. >abc GGCGGAGGUAGGGAGGCACGCGAUGGUAUUUCAGAGCCUCCCGAAUACAACUCCAGGGUAGGGUGUUGAAAGCGUUGGAGAUGUCUAAAGACACCGCCAG (((((.....(((((((.(..((.......)).).)))))))........(( ...
rnafold written 6 months ago by adhirajnath1420 • updated 6 months ago by JC9.7k
0
votes
0
answers
3.5k
views
0
answers
Comment: C: Problems Installing Vienna Rna
... Was the issue solved? ...
written 7 months ago by adhirajnath1420
1
vote
1
answer
797
views
1
answer
Sliding Window with specific window size and step size in BioPython
... I have multiple sequences in a fasta file and I want to divide it into sliding window with window size 90 and step size 10. I have a python script as follows: from Bio import SeqIO with open("my90_out.txt","w") as f: for seq_record in SeqIO.parse("myseq.fasta", "fasta"): ...
python biopython written 7 months ago by adhirajnath1420
0
votes
1
answer
372
views
1
answers
Comment: C: Extract flanking region of -500 nt upstream and downstream of BLAST result on ge
... Thank you so much. I'll use it and let you know if any problems ...
written 7 months ago by adhirajnath1420
0
votes
1
answer
192
views
1
answers
Comment: C: Adding -type arguments of blastn in Bioperl
... Thank you so much. It worked! ...
written 7 months ago by adhirajnath1420

Latest awards to adhirajnath14

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1160 users visited in the last hour