User: adhirajnath14

gravatar for adhirajnath14
Reputation:
40
Status:
New User
Location:
Last seen:
1 month, 2 weeks ago
Joined:
1 year, 6 months ago
Email:
a************@gmail.com

Posts by adhirajnath14

<prev • 18 results • page 1 of 2 • next >
0
votes
0
answers
196
views
0
answers
Comment: C: Problem installing RNAfold in CCLD
... Sorry about the inconvenience. I'm quite used to HTML tags, that's it. Will keep in mind from next time. Thanks. ...
written 7 months ago by adhirajnath1440
0
votes
0
answers
196
views
0
answers
Problem installing RNAfold in CCLD
... I have been using ViennaRNA package for quite sometime now. While trying to install it on HPC without root privileges I'm getting the following error on entering make command: CC constraints/soft.lo CC constraints/ligand.lo CCLD libRNA_constraints.la sorry - this ...
software error compilation rnafold installation written 7 months ago by adhirajnath1440 • updated 7 months ago by Ram32k
0
votes
0
answers
297
views
0
answers
Comment: C: Problem in QIIME: Cannot run OTU picking script.
... I am not sure if I'm missing anything. I have seen people following the same protocol and get the analysis done. ...
written 14 months ago by adhirajnath1440
0
votes
0
answers
297
views
0
answers
Problem in QIIME: Cannot run OTU picking script.
... I am working with metagenomic data where I have already joined the forward & reverse pairs and converted them to .fna format using QIIME scripts. As the next step is to pick OTUs, I'm trying to execute: pick_open_reference_otus.py -i input.fna -o otu_out/ However while running the script, ...
software error python metagenomics qiime written 14 months ago by adhirajnath1440 • updated 12 months ago by Biostar ♦♦ 20
0
votes
2
answers
569
views
2
answers
Comment: C: Calculating Shannon entropy for RNA sequences in multi-fasta using rnaentropy
... Thank you so much, Sir. You are a real life saver. ...
written 16 months ago by adhirajnath1440
0
votes
2
answers
569
views
2
answers
Comment: C: Calculating Shannon entropy for RNA sequences in multi-fasta using rnaentropy
... The program is not taking any file as input. I ran a pseudo code and got this result: ./RNAentropy -s AAGCGCGCGTGACTGCAT 2.562930 0.699157 18 -0.880430 Sorry I couldn't follow how to split fasta as you suggested, which would make the input a series of string for each sequence. S ...
written 16 months ago by adhirajnath1440
15
votes
2
answers
569
views
5 follow
2
answers
Calculating Shannon entropy for RNA sequences in multi-fasta using rnaentropy
... I have to calculate the Shannon entropy for a given list of sequences in a fasta file. Recently I came across a program called rnaentropy which solves my problem but the issue is I cannot run sequences in batch. In the documentation the input is given as a sequence of strings. The parameters in the ...
rnaentropy sequence rna written 16 months ago by adhirajnath1440 • updated 16 months ago by ole.tange4.0k
6
votes
1
answer
819
views
1
answer
Is there a way to get RNAFold output for multifasta in tabular format?
... I am trying to calculate the MFE along with the secondary structure for multifasta using RNAFold. The output generated is of the format. >abc GGCGGAGGUAGGGAGGCACGCGAUGGUAUUUCAGAGCCUCCCGAAUACAACUCCAGGGUAGGGUGUUGAAAGCGUUGGAGAUGUCUAAAGACACCGCCAG (((((.....(((((((.(..((.......)).).)))))))........(( ...
rnafold written 17 months ago by adhirajnath1440 • updated 17 months ago by JC12k
0
votes
0
answers
4.0k
views
0
answers
Comment: C: Problems Installing Vienna Rna
... Was the issue solved? ...
written 18 months ago by adhirajnath1440
1
vote
1
answer
2.0k
views
1
answer
Sliding Window with specific window size and step size in BioPython
... I have multiple sequences in a fasta file and I want to divide it into sliding window with window size 90 and step size 10. I have a python script as follows: from Bio import SeqIO with open("my90_out.txt","w") as f: for seq_record in SeqIO.parse("myseq.fasta", "fasta"): ...
python biopython written 18 months ago by adhirajnath1440

Latest awards to adhirajnath14

Popular Question 12 months ago, created a question with more than 1,000 views. For Sliding Window with specific window size and step size in BioPython

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1195 users visited in the last hour
_