User: Rezenman

gravatar for Rezenman
Rezenman0
Reputation:
0
Status:
New User
Last seen:
1 month ago
Joined:
1 year, 3 months ago
Email:
R*******@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by Rezenman

<prev • 10 results • page 1 of 1 • next >
0
votes
1
answer
359
views
1
answers
Comment: C: Demultiplexing based on dual indices in headers while allowing 1 mismatch to eac
... Hey all, Thanks for your help it worked good! ...
written 5 months ago by Rezenman0
0
votes
1
answer
359
views
1
answers
Comment: C: Demultiplexing based on dual indices in headers while allowing 1 mismatch to eac
... Hey Gabriel, I am adding some sequences for you to take a look, just to make sure that I understand correctly: in which format should I add the index files? Thanks a lot! @A00929:83:HL75TDRXX:1:2101:13919:1047 1:N:0:GTAGAGGA+NATCCTCT CATATTGATAGTTCGCACAGGTAG + FFFFFFFFFFFFFFFFFFFF ...
written 5 months ago by Rezenman0 • updated 5 months ago by genomax92k
0
votes
1
answer
359
views
1
answers
Comment: C: Demultiplexing based on dual indices in headers while allowing 1 mismatch to eac
... Hey Gabriel, Can it handle index sequences that are found in the headers ( such as the format I uploaded above)? ...
written 5 months ago by Rezenman0
0
votes
1
answer
359
views
1
answers
Comment: C: Demultiplexing based on dual indices in headers while allowing 1 mismatch to eac
... Thanks I'll look into that ...
written 5 months ago by Rezenman0
0
votes
1
answer
359
views
1
answers
Comment: C: Demultiplexing based on dual indices in headers while allowing 1 mismatch to eac
... Hey, thanks for the reply. According to my pipeline, I am usually working on the fastq files before demultiplexing (trimming, quality control, etc.), and demultiplex only in the last step, hence(and I forgot to mention), I am looking for a tool that can work with fastq files. Thanks ...
written 5 months ago by Rezenman0
4
votes
1
answer
359
views
1
answer
Demultiplexing based on dual indices in headers while allowing 1 mismatch to each index
... Hey all, I am looking for a tool that will help me demultiplexe my Novaseq samples by two dual indices in the headers. Since I have designed my indices such that the minimum hamming distance will be 3 I want to allow one mismatch per index while demultiplexing in order to salvage as many reads a pos ...
next-gen sequencing written 5 months ago by Rezenman0 • updated 5 months ago by Gabriel R.2.8k
0
votes
1
answer
163
views
1
answer
Quality filtering of reads with more than K bases under quality score
... Hey all, I am currently working on an analysis of barcode sequencing and looking for a tool to filter reads with K bases under a specific quality score. Does anyone have an idea of such a tool ? Thanks ahead ...
next-gen sequencing written 10 months ago by Rezenman0 • updated 10 months ago by ATpoint42k
0
votes
1
answer
571
views
1
answers
Comment: C: Removing bases from reads at specific positions (in the middle)
... Hey Buffo Thanks for the suggestion, however, I have found that all tools -including the abovementioned can only remove bases from the beginning /end of the read I am looking for a tool to help me remove 4 bases in the middle of the read according to their position. I can also settle for a tool tha ...
written 15 months ago by Rezenman0
0
votes
1
answer
571
views
1
answers
Comment: C: Removing bases from reads at specific positions (in the middle)
... Hey, I am working on a very specific custom pipeline in which I have to remove 4 bases from the middle read - they are found in the same position in all of the reads ...
written 15 months ago by Rezenman0
0
votes
1
answer
571
views
1
answer
Removing bases from reads at specific positions (in the middle)
... Hey guys ! I was looking for a tool to remove a specific number of bases at a specific location (in the middle of the read) from a fastq file, Does anyone know any way of doing it ? Thanks ! ...
assembly next-gen sequencing written 15 months ago by Rezenman0 • updated 15 months ago by Buffo1.8k

Latest awards to Rezenman

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1098 users visited in the last hour