User: tikshyadav19

gravatar for tikshyadav19
Reputation:
0
Status:
New User
Last seen:
5 days, 1 hour ago
Joined:
3 months, 2 weeks ago
Email:
t***********@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by tikshyadav19

<prev • 13 results • page 1 of 2 • next >
0
votes
0
answers
75
views
0
answers
Comment: A: Merge transcripts from all samples:
... Why to merge transcripts? ...
written 6 days ago by tikshyadav190
0
votes
0
answers
75
views
0
answers
Comment: C: Merge transcripts from all samples:
... I just want to know why to merge transcripts using Stringtie? ...
written 6 days ago by tikshyadav190
1
vote
0
answers
75
views
5 follow
0
answers
Merge transcripts from all samples:
... Why do we need to merge transcripts while assembly? I need its importance or significance ...
assembly written 6 days ago by tikshyadav190
0
votes
1
answer
82
views
1
answers
Comment: C: Tophat2 RNA seq mapping
... in the above mentioned folder : /scratch/sbag/Tikshana/Ath/index/Bowtie_Ath/ ...
written 16 days ago by tikshyadav190
0
votes
1
answer
82
views
1
answers
Comment: C: Tophat2 RNA seq mapping
... may I know difference between Tophat2 and Hisat2 ...
written 16 days ago by tikshyadav190
0
votes
1
answer
82
views
1
answers
Comment: A: Tophat2 RNA seq mapping
... These are the index output files: Bowtie_Ath.1.bt2 Bowtie_Ath.2.bt2 Bowtie_Ath.3.bt2 Bowtie_Ath.4.bt2 Bowtie_Ath.rev.1.bt2 Bowtie_Ath.rev.2.bt2 ...
written 16 days ago by tikshyadav190
3
votes
1
answer
82
views
5 follow
1
answer
Tophat2 RNA seq mapping
... Hi, I am trying to run tophat2 using following tophat command: tophat -p 8 -G /scratch/sbag/Tikshana/Ath/index/Bowtie_Ath/Bowtie_Ath -o /scratch/sbag/Tikshana/Ath/map/Athctrl_tophat/ genome /scratch/sbag/Tikshana/Ath/Athctrl_1P.fastq /scratch/sbag/Tikshana/Ath/Athctrl_2P.fastq I am getting th ...
rna-seq written 16 days ago by tikshyadav190 • updated 16 days ago by ATpoint26k
0
votes
0
answers
337
views
0
answers
Comment: C: Python Program to read .fasta file to .txt file
... i want to count NT after it converts in .txt ...
written 12 weeks ago by tikshyadav190
1
vote
0
answers
140
views
0
answers
converting SRA to Fastq file by fastq-dump
... how to convert SRRXXXXXX.sra to SRRXXXXXX.fastq using fastq-dump using linux comands? ...
sra to fastq fastq-clump written 12 weeks ago by tikshyadav190
0
votes
0
answers
337
views
0
answers
Comment: C: Python Program to read .fasta file to .txt file
... dna.fastq has format as >dna00022 ATATTCGGATTCGAGCTTAGGT and dna.txt has format as ATATTCGGATTCGAGCTTAGGT along with it should count the number of nucleotides in dna.txt by using python program in idle script ...
written 12 weeks ago by tikshyadav190

Latest awards to tikshyadav19

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 856 users visited in the last hour