User: christina.galonska

Reputation:
10
Status:
New User
Location:
Last seen:
6 hours ago
Joined:
2 weeks, 5 days ago
Email:
c*****************@gmail.com

Posts by christina.galonska

<prev • 2 results • page 1 of 1 • next >
2
votes
1
answer
77
views
1
answers
Answer: A: Trim fastq after and before motif occurance
... Just tested seqkit amplicon which actually did exactly that (option is only available in the pre-release of version v0.11.0 so far: https://github.com/shenwei356/seqkit/releases/tag/v0.11.0-dev) Corresponding command would be: seqkit amplicon input.fastq -F GGGGCCCC -r -5:3 -f -o output.fastq ...
written 19 days ago by christina.galonska10
2
votes
1
answer
77
views
1
answer
Trim fastq after and before motif occurance
... Hi everyone, Is there any easy way to trim a fasta/fastq before and after a certain motif occurance? As example, this would be my sequence ATGAAACCTTTGGGGCCCCAGTCAGCTC My motif of interest would be: GGGGCCCC I want to trim let's say 5bp 5' and 3bp 3' of the motif occurance which would give you: ...
next-gen sequencing written 19 days ago by christina.galonska10

Latest awards to christina.galonska

Scholar 19 days ago, created an answer that has been accepted. For A: Trim fastq after and before motif occurance

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1910 users visited in the last hour