User: christina.galonska

New User
Last seen:
10 months, 2 weeks ago
11 months, 1 week ago

Posts by christina.galonska

<prev • 2 results • page 1 of 1 • next >
Answer: A: Trim fastq after and before motif occurance
... Just tested seqkit amplicon which actually did exactly that (option is only available in the pre-release of version v0.11.0 so far: Corresponding command would be: seqkit amplicon input.fastq -F GGGGCCCC -r -5:3 -f -o output.fastq ...
written 11 months ago by christina.galonska10
Trim fastq after and before motif occurance
... Hi everyone, Is there any easy way to trim a fasta/fastq before and after a certain motif occurance? As example, this would be my sequence ATGAAACCTTTGGGGCCCCAGTCAGCTC My motif of interest would be: GGGGCCCC I want to trim let's say 5bp 5' and 3bp 3' of the motif occurance which would give you: ...
next-gen sequencing written 11 months ago by christina.galonska10

Latest awards to christina.galonska

Scholar 11 months ago, created an answer that has been accepted. For A: Trim fastq after and before motif occurance


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 984 users visited in the last hour