User: claping

gravatar for claping
claping0
Reputation:
0
Status:
New User
Last seen:
6 months, 3 weeks ago
Joined:
9 months ago
Email:
c**********@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by claping

<prev • 12 results • page 1 of 2 • next >
0
votes
1
answer
410
views
1
answers
Answer: A: Convert nucleotide fasta of contigs to protein sequence genbank
... Thanks @Joe. I see now that I misinterpreted the vignette. This is a weird bacteria, but there is an appropriate reference genome for it ([located here][1]). I am able to download the DNA fasta file for this reference genome. However, it seems that I need a file like (referenceproteins.fasta or refe ...
written 6 months ago by claping0
0
votes
1
answer
410
views
1
answers
Comment: C: Convert nucleotide fasta of contigs to protein sequence genbank
... Thanks @SishuoWang. I am hoping to input the *unknown genome* itself in *protein* sequence. Do you think this is possible in Prokka? Or, is it only possible to supply a *reference genome* in *protein sequence* (along with the unknown genome in DNA sequence)? I may be misunderstanding the Prokka [vig ...
written 6 months ago by claping0
0
votes
1
answer
410
views
1
answers
Comment: C: Convert nucleotide fasta of contigs to protein sequence genbank
... Thanks @Joe. I had ran Prokka genome annotation analysis using the input of the genome I want annotated in the .fasta format of DNA sequence of contigs (with an example of the format shown in my original post). However, I wanted to convert that .fasta format input into its corresponding amino acid s ...
written 6 months ago by claping0
4
votes
1
answer
410
views
1
answer
Convert nucleotide fasta of contigs to protein sequence genbank
... I recently ran Prokka on a .fasta file of ordered contig DNA sequences. The file looks like this: >NODE_6_length_103505_cov_20.694918 agcgattagcccccagcgattagcgaaaagcgattttttattagcgattagcgattagcg attagcgattagcgattttagaactatttgcctaaatttctgcttaaatatctacagaaa The annotation went (fairly ...
fasta nucleotide protein genbank prokka written 7 months ago by claping0
0
votes
1
answer
193
views
1
answers
Comment: C: rRNA and bacteria: Absence and duplicates
... Thanks @massa.kassa.sc3na. Thanks for this suggestion. This time, I reran Prokka using --rfram (prokka --rfram input.fasta). I had the same number of "rRNA" (and they were still 16S and 23S). However, one difference is that I now had 4 "misc_RNA". These had lengths of 292, 384, 320, and 294. There p ...
written 7 months ago by claping0
3
votes
1
answer
193
views
1
answer
rRNA and bacteria: Absence and duplicates
... 1) I have tried using [Barrnap][1] and [Prokka][2] for prokaryote genome annotation. In both cases, I was unable to discover/annotate the 5SrRNA in an unknown/new bacteria assembly. I tried both these methods as well with a known bacteria (that was expected to have two 5SrRNA) and did not come to s ...
bacteria 5srrna 23srrna 16srrna written 7 months ago by claping0 • updated 7 months ago by h.mon30k
0
votes
0
answers
229
views
0
answers
Comment: C: Detecting variants in mapped reads against 16S rRNA reference sequence
... It was assembled from reads each about 150 base pairs. I obtained coverage looking at the results of running metaspades (which gave contigs.fasta). This resulted in 81 contigs. The header for each contig looked like `>NODE_81_length_78_cov_21.000000`. So, I considered this contig to have coverage ...
written 8 months ago by claping0
0
votes
0
answers
280
views
0
answers
Comment: C: Prokka and plasmidspades unexpectedly reveal no plasmid
... I compared the genome assembly to the "known" genome using MAUVE. They were quite similar (only about 20 LCBs at the default settings). In terms of your last sentence, how can I find the plasmid in the assembly? What tools should I use? This may be a simple question but I am new to this type of anal ...
written 8 months ago by claping0
0
votes
0
answers
280
views
0
answers
Comment: C: Prokka and plasmidspades unexpectedly reveal no plasmid
... Total reads are about 480,610. Reads are about 150 base pairs. I do not have much experience at all with this subject and am unsure how to even examine which region of the known plasmid the reads are aligning to. I simply ran code I found online as follows: bwa index plasmid.fasta; bwa mem plasmid.f ...
written 8 months ago by claping0
2
votes
0
answers
280
views
0
answers
Prokka and plasmidspades unexpectedly reveal no plasmid
... I have two similar genomes (one "known", one "unknown"). The "known" genome has already been determined to contain a plasmid. Both Prokka and plasmidspades have unexpectedly shown no results for plasmids in either genomes. In the case of plasmidspades, I ran the following commands: plasmidspade ...
plasmid spades prokka plasmidspades written 8 months ago by claping0

Latest awards to claping

Scholar 6 months ago, created an answer that has been accepted. For A: Convert nucleotide fasta of contigs to protein sequence genbank

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1559 users visited in the last hour