User: loui_

gravatar for loui_
loui_0
Reputation:
0
Status:
New User
Last seen:
1 day ago
Joined:
1 week, 6 days ago
Email:
c*******************@mdc-berlin.de

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by loui_

<prev • 7 results • page 1 of 1 • next >
0
votes
2
answers
761
views
2
answers
Comment: C: Non-ascii characters in bam file cause htseq-count error
... As stated above, the solution to all problems was installing the newest version of STAR (2.7.1 in my case). I assume this is a bug in the older versions! Thanks for your help. ...
written 13 days ago by loui_0
0
votes
2
answers
761
views
2
answers
Comment: C: Non-ascii characters in bam file cause htseq-count error
... I installed the newest STAR version available on our system (2.7.1a), run everything again and this indeed resolved the problem! Thanks a lot! Do you want to post your comment as a reply so I can accept it? ...
written 13 days ago by loui_0
0
votes
2
answers
761
views
2
answers
Comment: C: Non-ascii characters in bam file cause htseq-count error
... Good observation, thanks a lot! I checked some other sequences and that seems to be the problem. Nevertheless, I can't come up with a solution.. I already allow 6 mismatches in the alignment but obviously that doesn't change the Ns. I also checked the reads in IGV and all the ones I checked are int ...
written 13 days ago by loui_0
0
votes
2
answers
761
views
2
answers
Comment: C: Non-ascii characters in bam file cause htseq-count error
... I used this because I used it for other experiments as well but that's a good idea. I will give it a try. ...
written 13 days ago by loui_0
0
votes
2
answers
761
views
2
answers
Comment: C: Non-ascii characters in bam file cause htseq-count error
... That's true, but I'm guessing that it is not really a question mark, otherwise I would be able to grep it via ''grep '?''', but I can't. Correct? The line in the fasta file also looks normal.. ...
written 13 days ago by loui_0
0
votes
2
answers
761
views
2
answers
Comment: C: Non-ascii characters in bam file cause htseq-count error
... As I said, the line in the bam file looks normal, it just contains a question mark: A00125:103:HF5GFDSXX:1:1458:14696:27445 83 14 63373824 255 101M = 63373767 -158 TGAGATCTGTCTGTCTCAGCCTCCCAAGGGCTGGAATCACAAGCTTGAGCCATTACACCTGTCTCTTACGCCATCTAATTCCACCCTAATCTCCATCTCCC FFFFFFFFFFFFFFFFFFFFFFFFFFFF ...
written 13 days ago by loui_0
5
votes
2
answers
761
views
2
answers
Non-ascii characters in bam file cause htseq-count error
... Hi everybody, I have aligned bam files (STAR version 2.6.1) and want to quantify them using htseq-count (version 0.9.1). Some bams run through without a problem but some give following error: ---------- ... 13300000 SAM alignment record pairs processed. 13400000 SAM alignment recor ...
htseq-count star rna-seq written 13 days ago by loui_0 • updated 13 days ago by swbarnes26.7k

Latest awards to loui_

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2382 users visited in the last hour