User: Bioinfo

gravatar for Bioinfo
Bioinfo20
Reputation:
20
Status:
New User
Location:
Morocco
Last seen:
2 weeks ago
Joined:
10 months, 1 week ago
Email:
m*******@gmail.com

Posts by Bioinfo

<prev • 96 results • page 2 of 10 • next >
1
vote
1
answer
122
views
1
answer
Merging three assembly results and elimination of duplication
... Hello Biostar ! I hope you're doing well i did assembly using 3 type of sequencing , Hiseq Data MIseq Data and mixed (Hiseq Miseq ) , to improve the next results i'm thinking about merging the results of assembly of these three data ( Hiseq contigs , Miseq contigs and Mixed Hiseq Miseq contigs ) ...
assembly alignment sequencing written 4 months ago by Bioinfo20 • updated 4 months ago by N15120
0
votes
0
answers
217
views
0
answers
Comment: C: how to determine the percentage of the coverage
... I'm sorry i mean in genome level because i want to know how much my reads covered the reference genome ...
written 5 months ago by Bioinfo20
0
votes
0
answers
217
views
0
answers
Comment: C: how to determine the percentage of the coverage
... percentage at genome, i m little bit confused , , can you tell me how can i do that ( use the informations above to calcule the percentage of coverage ) and sorry for asking too many questions ...
written 5 months ago by Bioinfo20
0
votes
0
answers
217
views
0
answers
Comment: C: how to determine the percentage of the coverage
... i used qualimap and i obtained the informations mentioned above in genome_results.txt , please tell me where i can find the percentage of the average ? ...
written 5 months ago by Bioinfo20
0
votes
0
answers
217
views
0
answers
Comment: C: how to determine the percentage of the coverage
... Thank you for your reply i will check the link , just because i looked for the different tools and i tried them but i didn't obtain the information i look for , that's why i asked the question ...
written 5 months ago by Bioinfo20
1
vote
0
answers
217
views
0
answers
how to determine the percentage of the coverage
... Hello Biostar I hope you're doing well i mapped my reads against the reference genome to get an idea about the coverage , what i want to know is the percentage of the coverage , but i don't know how to obtain this information using the diffrent tools i know , in qualimap , i just found **the mean ...
assembly alignment sequencing written 5 months ago by Bioinfo20
2
votes
1
answer
149
views
5 follow
1
answer
Counting speceficspecific lines that dosen't conaint speceficdon't contain specific word
... Please I have question: I have a file like this @HWI-ST273:296:C0EFRACXX:2:2101:17125:145325/1 TTAATACACCCAACCAGAAGTTAGCTCCTTCACTTTCAGCTAAATAAAAG + 8?8A;DDDD;@?++8A?;C;F92+2A@19:1*1?DDDECDE?B4:BDEEI @BBBB-ST273:296:C0EFRACXX:2:1303:5281:183410/1 TAGCTCCTTCGCTTTCAGCTAAATAAA ...
assembly alignment sequencing written 5 months ago by Bioinfo20 • updated 5 months ago by Alex Reynolds30k
0
votes
0
answers
174
views
0
answers
Comment: C: cd-hit redondancy Fatal Error: in diag_test_aapn, MAX_DIAG reached Program halte
... Ahhh , i didn't know that , thank you very much for telling me and yes , just becausei tried to do some analysis i never did before , i feel little bit confused , sorry ...
written 5 months ago by Bioinfo20
0
votes
0
answers
174
views
0
answers
Comment: C: cd-hit redondancy Fatal Error: in diag_test_aapn, MAX_DIAG reached Program halte
... Hello , Thank you for your reply Actually , my aim is to eliminate the duplicated sequences in my library file , so i can determine the coverage of my reads against this library , if i didn't remove the duplication that s will affect the result of coverage ...
written 5 months ago by Bioinfo20
1
vote
0
answers
174
views
0
answers
cd-hit redondancy Fatal Error: in diag_test_aapn, MAX_DIAG reached Program halted !!
... Hello . Please i have problem i wanted to create database for specific bacteria genre , foe that i downloaded all this bacteria genre sequences published on ncbi , and i merge all the fna files in one fasta file , then i used cd-hit to eliminate redundancy , i used the following command . cd-hi ...
software error assembly alignment written 5 months ago by Bioinfo20

Latest awards to Bioinfo

Supporter 4 months ago, voted at least 25 times.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1589 users visited in the last hour