User: misslaurenheadley

Reputation:
10
Status:
New User
Location:
London
Last seen:
2 months, 2 weeks ago
Joined:
2 months, 2 weeks ago
Email:
m****************@gmail.com

Posts by misslaurenheadley

<prev • 5 results • page 1 of 1 • next >
1
vote
1
answer
188
views
1
answers
Answer: A: Could not locate bowtie index (miRDeep2 analysis)
... Solution: (I have been using 'Big Data Analysis for Bioinformatics and Biomedical Discoveries, by Shui Qing Ye) There are some errors in the book, but this one was all me, When linking the the genome and the bowtie index into the current working directory: ln -s ./Homo_sapiens/UCSC/hg38/ ...
written 11 weeks ago by misslaurenheadley10
0
votes
1
answer
188
views
1
answers
Comment: C: Could not locate bowtie index (miRDeep2 analysis)
... Have figured it out. I missed a full stop when I linked the bowtie sequences. It was looking through the root directory rather than from the current directory I was in. I learned that black highlight of anything that you ls is not a good thing! ...
written 11 weeks ago by misslaurenheadley10
0
votes
1
answer
188
views
1
answers
Comment: C: Could not locate bowtie index (miRDeep2 analysis)
... Hey, Thank you for the suggestions. Still hasn't worked. Frustratingly, I have copies that have been trimmed already, I was just trying to do an all in one alignment. Is this what you use for alignment? Back to the drawing board. bw, L ...
written 11 weeks ago by misslaurenheadley10
0
votes
1
answer
188
views
1
answers
Comment: C: Could not locate bowtie index (miRDeep2 analysis)
... Hi, Ty for the suggestion! I tried -p genome. -bash-4.2$ mapper.pl Test_1.fq -e -j -k AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -l 18 -m -h -p genome. -s reads_collapsed.fa -t reads_collapsed_vs_genome.arf -o 4 -v parsing fastq to fasta format disc ...
written 11 weeks ago by misslaurenheadley10
1
vote
1
answer
188
views
1
answer
Could not locate bowtie index (miRDeep2 analysis)
... Hi, I have no idea what I've done wrong. I'm trying to run miRDeep2 on some miRNA seq runs. I have linked the bowtie (1) index files to the current directory, and (attempted) to save a path to the originals anyway, I kep getting an error message saying it can't find them. Below is the script sh ...
mirna mirdeep2 bowtie index rna-seq written 11 weeks ago by misslaurenheadley10

Latest awards to misslaurenheadley

Scholar 11 weeks ago, created an answer that has been accepted. For A: Could not locate bowtie index (miRDeep2 analysis)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1467 users visited in the last hour