User: shelley.w.peterson

Reputation:
10
Status:
New User
Location:
Last seen:
4 months, 1 week ago
Joined:
9 months, 1 week ago
Email:
s*****************@gmail.com

Posts by shelley.w.peterson

<prev • 11 results • page 1 of 2 • next >
0
votes
0
answers
184
views
0
answers
Comment: C: Use facet_plot to display a dot plot of dates (x) vs phylogenetic tree order (y)
... It's a phylogenetic tree showing the relatedness between the samples. The order of the samples in the phylogenetic tree is how they should be plotted on the y axis on the dot plot. p2 <- ggtree(phylo) %<+% dd2 + geom_tippoint(shape = 21, aes(fill = Province), size=2.75, color = "bl ...
written 4 months ago by shelley.w.peterson10
0
votes
0
answers
184
views
0
answers
Comment: C: Use facet_plot to display a dot plot of dates (x) vs phylogenetic tree order (y)
... dd2 is really large, but here's dd5 (the columns match as expected) id value prov 1 ERR1515431 2011-01-01 UK 2 ERR1515463 2011-01-01 UK 3 ERR1515483 2011-01-01 UK 4 ERR1515516 2012-01-01 UK 5 ERR1515525 2012-01-01 UK 6 ERR1515541 2012-01-01 UK ...
written 4 months ago by shelley.w.peterson10
0
votes
0
answers
184
views
0
answers
Use facet_plot to display a dot plot of dates (x) vs phylogenetic tree order (y) in R
... I am trying to generate a dot plot alongside my phylogenetic tree, with x axis = date and y axis is sample in the same order as a phylogenetic tree. dd5 is my info table and p2 is my tree. dd5 <- drop_na(data.frame(id = dd2$Number, value = as.Date(dd2$Date.Collected, "%Y-%m-%d", origin = "20 ...
phylogeny R ggplot2 written 4 months ago by shelley.w.peterson10 • updated 4 months ago by RamRS30k
2
votes
1
answer
294
views
1
answer
Extract subsequences from a fastA file with specific start sequence and length in R
... I have a fasta file of sequences and I am trying to trim them all to a specific length starting with a specific pattern >seq1 ACTGCTAGCCCAGTCTGACTGACTGACTGTGTCATG >seq2 ATCTGATGTGTGCCCCAGTGACTGACTGATGGGCCC >seq3 CTGATGCCCAGTCGAGCTAGCATTGCCCAAATTGGCCATGCTGATGCTG ...
gene R dna written 7 months ago by shelley.w.peterson10 • updated 7 months ago by swbarnes28.6k
0
votes
0
answers
117
views
0
answers
(Closed) Remove all rows in a df that contain values from a list in R
... I'm working in R and I have a data.frame that looks like this: v1 v2 v3 1 131 456 2 4 131 3 685 184 4 124 384 5 13184 2 and I have a list of numbers that I want removed: Bad <- paste(c("13584", "131", "40", "134")) a ...
R written 7 months ago by shelley.w.peterson10
0
votes
0
answers
305
views
0
answers
Comment: C: Replace list of sequence names with sequences from a fasta file using R
... Is there an instruction segment for how to properly format a post? I was proud enough of myself for thinking to put in "< br >" when pressing the enter button didn't work. I'm a biologist not a programmer, so I don't know these things. ...
written 9 months ago by shelley.w.peterson10
0
votes
0
answers
305
views
0
answers
Comment: C: Replace list of sequence names with sequences from a fasta file using R
... Thanks so much!!!! As someone who is new to coding, sometimes it's hard to figure out if I'm using the wrong tool/command or if I'm using the correct one the wrong way -_-' ...
written 9 months ago by shelley.w.peterson10
0
votes
0
answers
305
views
0
answers
Comment: C: Replace list of sequence names with sequences from a fasta file using R
... list of sequence names: A1 A2 A3 A1 A1 A2 fasta file: >A1 ATCATC >A2 CCCGGG >A3 GTGTGT >A4 TCTATC >A5 ATCTAC output: >A1 ATCATC >A2 CCCGGG >A3 GTGTGT Desired output: ATCATC ...
written 9 months ago by shelley.w.peterson10 • updated 9 months ago by RamRS30k
1
vote
0
answers
305
views
0
answers
Replace list of sequence names with sequences from a fasta file using R
... I have a list of sequence names (A1, A2, A3, A1, A1, A2 etc) and a fasta file with the names and sequences, and I am trying to find a way to replace each item on the list with the corresponding sequence from the fasta file. I've used: test <- sequences[names(sequences) %in% list] which ju ...
R sequence written 9 months ago by shelley.w.peterson10 • updated 9 months ago by RamRS30k
0
votes
1
answer
279
views
1
answers
Comment: C: Extract sequences from fastA files based on csv chart
... I realized I forgot to state that I specifically need this for R. I've actually already written this for perl and it works great, but I'm trying to rewrite it for R for some of my labmates who have trouble with command line programs. The ultimate goal is to rewrite all of my perl scripts to be used ...
written 9 months ago by shelley.w.peterson10

Latest awards to shelley.w.peterson

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1834 users visited in the last hour