User: shelley.w.peterson

Reputation:
10
Status:
New User
Location:
Last seen:
4 days, 8 hours ago
Joined:
2 months ago
Email:
s*****************@gmail.com

Posts by shelley.w.peterson

<prev • 8 results • page 1 of 1 • next >
2
votes
1
answer
61
views
1
answer
Extract subsequences from a fastA file with specific start sequence and length in R
... I have a fasta file of sequences and I am trying to trim them all to a specific length starting with a specific pattern >seq1 ACTGCTAGCCCAGTCTGACTGACTGACTGTGTCATG >seq2 ATCTGATGTGTGCCCCAGTGACTGACTGATGGGCCC >seq3 CTGATGCCCAGTCGAGCTAGCATTGCCCAAATTGGCCATGCTGATGCTG ...
gene R dna written 4 days ago by shelley.w.peterson10 • updated 4 days ago by swbarnes27.4k
0
votes
0
answers
47
views
0
answers
(Closed) Remove all rows in a df that contain values from a list in R
... I'm working in R and I have a data.frame that looks like this: v1 v2 v3 1 131 456 2 4 131 3 685 184 4 124 384 5 13184 2 and I have a list of numbers that I want removed: Bad <- paste(c("13584", "131", "40", "134")) a ...
R written 11 days ago by shelley.w.peterson10
0
votes
0
answers
189
views
0
answers
Comment: C: Replace list of sequence names with sequences from a fasta file using R
... Is there an instruction segment for how to properly format a post? I was proud enough of myself for thinking to put in "< br >" when pressing the enter button didn't work. I'm a biologist not a programmer, so I don't know these things. ...
written 8 weeks ago by shelley.w.peterson10
0
votes
0
answers
189
views
0
answers
Comment: C: Replace list of sequence names with sequences from a fasta file using R
... Thanks so much!!!! As someone who is new to coding, sometimes it's hard to figure out if I'm using the wrong tool/command or if I'm using the correct one the wrong way -_-' ...
written 8 weeks ago by shelley.w.peterson10
0
votes
0
answers
189
views
0
answers
Comment: C: Replace list of sequence names with sequences from a fasta file using R
... list of sequence names: A1 A2 A3 A1 A1 A2 fasta file: >A1 ATCATC >A2 CCCGGG >A3 GTGTGT >A4 TCTATC >A5 ATCTAC output: >A1 ATCATC >A2 CCCGGG >A3 GTGTGT Desired output: ATCATC ...
written 8 weeks ago by shelley.w.peterson10 • updated 8 weeks ago by RamRS25k
1
vote
0
answers
189
views
0
answers
Replace list of sequence names with sequences from a fasta file using R
... I have a list of sequence names (A1, A2, A3, A1, A1, A2 etc) and a fasta file with the names and sequences, and I am trying to find a way to replace each item on the list with the corresponding sequence from the fasta file. I've used: test <- sequences[names(sequences) %in% list] which ju ...
R sequence written 8 weeks ago by shelley.w.peterson10 • updated 8 weeks ago by RamRS25k
0
votes
1
answer
148
views
1
answers
Comment: C: Extract sequences from fastA files based on csv chart
... I realized I forgot to state that I specifically need this for R. I've actually already written this for perl and it works great, but I'm trying to rewrite it for R for some of my labmates who have trouble with command line programs. The ultimate goal is to rewrite all of my perl scripts to be used ...
written 8 weeks ago by shelley.w.peterson10
1
vote
1
answer
148
views
1
answer
Extract sequences from fastA files based on csv chart in R
... I have 2 fasta files - we'll call them A and B, each with several thousand sequences labelled A1, A2, A3 or B1, B2, B3 etc. I also have a .csv file that has 3 columns: ST1 A1 B1 ST2 A1 B2 ST3 A3 B1 I need to combine these all into a single fasta file that looks like this: ...
R sequencing written 8 weeks ago by shelley.w.peterson10

Latest awards to shelley.w.peterson

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1197 users visited in the last hour