User: XiaoqianSun

gravatar for XiaoqianSun
Reputation:
0
Status:
New User
Last seen:
1 week ago
Joined:
8 months, 1 week ago
Email:
x**************@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by XiaoqianSun

<prev • 6 results • page 1 of 1 • next >
0
votes
0
answers
224
views
0
answers
Comment: C: sequence in bam file looks weird
... Oh, I see. That's the problem. Thank you for your help. ...
written 8 months ago by XiaoqianSun0
0
votes
0
answers
224
views
0
answers
Comment: C: sequence in bam file looks weird
... Hi, This is how HSPA12 looks like in IGV after zoom in a little bit. you can see that reads in intron area are much more than that in exon area which should not happen. ![enter image description here][1] [1]: https://biostars.s3.amazonaws.com/HSPA12_zoomin.png ...
written 8 months ago by XiaoqianSun0
0
votes
0
answers
224
views
0
answers
Comment: C: sequence in bam file looks weird
... I'm still figuring out how to insert img here. Will upload IGV screen shot later. Can you please also take a look at this record: SRR6761461.11957243 161 chr10 14878790 50 51M = 14879032 293 GCGTGGTGGTGGTGCCTTTAGTACCAGCTACTTGGGAGGCTGAGGCAGGAG 33:0BDGGB/FG@:FB>@11=DGGG1CE1=1E0EF/=0=:FG0/=/EF ...
written 8 months ago by XiaoqianSun0
0
votes
0
answers
224
views
0
answers
Comment: C: sequence in bam file looks weird
... Got it. Will do next time. Thank you. ...
written 8 months ago by XiaoqianSun0
0
votes
0
answers
224
views
0
answers
Comment: C: sequence in bam file looks weird
... That's the output of IRTools, a tool to extract exon read and intron read. CER_read_count represents exon read count. ...
written 8 months ago by XiaoqianSun0
2
votes
0
answers
224
views
0
answers
sequence in bam file looks weird
... Hi all, My major is data science and I know little about RNA-seq. However, I'm analyzing RNA-sequencing data for a lab and I found that the CER_read_count for a CTL sample is much lower than other samples. Then, I traced back to bam file, picked a gene whose CER_read_count is very low, extracted al ...
sequence samtools written 8 months ago by XiaoqianSun0

Latest awards to XiaoqianSun

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1151 users visited in the last hour