User: agata

gravatar for agata
agata0
Reputation:
0
Status:
New User
Last seen:
8 hours ago
Joined:
2 months, 1 week ago
Email:
a**********@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by agata

<prev • 17 results • page 1 of 2 • next >
1
vote
1
answer
64
views
1
answers
Answer: A: testing similarity of covarege for pair of genes / Fisher test? / contingency ta
... I gave up idea of applying Fisher test after all. Instead I applied the machine learning solution: I plotted all genes with the number of reads and clustered it by k-means, without defining the number of clusters. After all I got two clusters and the pair of gene that I was interested in was placed ...
written 5 days ago by agata0
0
votes
0
answers
55
views
0
answers
fastq headers problem with Trinity
... I downloaded data as SRA file and used fastq_dump according to Trinity recommendations. fastq-dump --skip-technical --readids --read-filter pass --dumpbase --defline-seq '@$sn[_$rn]/$ri' --split-files ./SRR.sra Then I run quality control with FastQC and trimmed out adapters with trimmomatic. ...
trinity fastq written 5 days ago by agata0
0
votes
2
answers
163
views
2
answers
Comment: C: Editing fastq file
... Trinity recommends using this line when data are downloaded as SRA. fastq-dump --defline-seq '@$sn[_$rn]/$ri' --split-files file.sra I am sorry, I couldn't find specific requirements of the name/id of reads and I am not sure how this parameter works > --defline-seq '@$sn[_$rn]/$ri' Here ...
written 6 days ago by agata0
0
votes
2
answers
163
views
2
answers
Comment: C: Editing fastq file
... I had to use the fastq-dump line preferred by Trinity as my goal is to do assembly. I used this line: fastq-dump --outdir fastq --gzip --skip-technical --readids --read-filter pass --dumpbase --defline-seq '@$sn[_$rn]/$ri' --split-files ./SRR.sra Unfortunately now, after applying awk Trinity ...
written 6 days ago by agata0
0
votes
2
answers
163
views
2
answers
Comment: C: Editing fastq file
... I downloaded data from [NCBI][1] It seems that was produced by Illumina HiSeq 2000... So who knows what was done before uploading... ¯\_(ツ)_/¯ Could it be fault of Illimina? [1]: https://www.ncbi.nlm.nih.gov/sra/SRR5874687 ...
written 7 days ago by agata0
0
votes
2
answers
163
views
2
answers
Comment: C: Editing fastq file
... Thank you once more! It works perfectly now :) ...
written 7 days ago by agata0
0
votes
2
answers
163
views
2
answers
Comment: C: Editing fastq file
... I'm really sorry for confusion... I had to paste it from two terminals... of course it is not correct ...
written 7 days ago by agata0
0
votes
2
answers
163
views
2
answers
Comment: C: Editing fastq file
... Thank you very much for help! Is it always the case that first read has 5 lines? As there is additional line with length = 100 after "+"? ...
written 7 days ago by agata0
4
votes
2
answers
163
views
2
answers
Editing fastq file
... One of the fastq file that I am analysing has IDs of the reads not in the first line, but in the third, after "+". I would appreciate any tips how to reorganise it. head -n 3 file.fasta @/1 GACCGTAGCCGTGGTATTTACTTCACTCAAGACTGGTGTTCAATGCCAGGTGTTATGCCAGTTGCTTCAGGTGGTATTCACGTATGGCACATGCC ...
fastq bash written 7 days ago by agata0 • updated 7 days ago by Istvan Albert ♦♦ 83k
1
vote
1
answer
64
views
1
answer
testing similarity of covarege for pair of genes / Fisher test? / contingency table
... I would like to know whether the pair of chosen genes have similar coverage. To do so, I think it will be good to apply the Fisher test (maybe not?) However, I have a problem with creating a contingency table. From summary featureCounts table (before normalisation) I took the number of all aligned ...
fisher test coverage written 12 days ago by agata0

Latest awards to agata


Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1041 users visited in the last hour