User: jiseon824

gravatar for jiseon824
jiseon8240
Reputation:
0
Status:
New User
Last seen:
1 month ago
Joined:
1 month ago
Email:
j********@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by jiseon824

<prev • 3 results • page 1 of 1 • next >
0
votes
0
answers
120
views
0
answers
Comment: C: Count duplicate sequence in fasta file using python
... Thank you so much. it is working well. :) I hope it is working well with my massive data. ...
written 4 weeks ago by jiseon8240
0
votes
0
answers
120
views
0
answers
Comment: C: Count duplicate sequence in fasta file using python
... Hi I want to check the number of occurrences of specific reference sequence in reference file. for example, if i make a reference file as bleow > ref#1 cagatcaccttgaagtcgtctgctcctacgctggtgaaacctacac >ref#2 gccttctctgggttctcactcagcactagtggagtgggtgtgggctgga ...
written 4 weeks ago by jiseon8240 • updated 4 weeks ago by genomax85k
0
votes
0
answers
120
views
0
answers
Count duplicate sequence in fasta file using python
... Hello I am new for python and bioinformatics. for some reason, I have to analyze the data from a massive fasta file. I want to count to repeat sequence using python. test.fasta >1234 cagatcaccttgaagtcgtctgctcctacgctggtgaaacctacac >456 cagatcaccttgaagtcgtctgctcctacgc ...
rna-seq written 4 weeks ago by jiseon8240 • updated 4 weeks ago by RamRS27k

Latest awards to jiseon824

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 953 users visited in the last hour