User: Suk211

gravatar for Suk211
Suk2111.0k
Reputation:
1,030
Status:
New User
Location:
state college
Website:
http://twitter.com/suk211
Last seen:
9 years, 2 months ago
Joined:
10 years, 12 months ago
Email:
s**************@gmail.com

interested systems biology,protein folding ,genomics

Posts by Suk211

<prev • 20 results • page 2 of 2 • next >
11
votes
3
answers
2.6k
views
5 follow
3
answers
How To Charecterize A Residue In A Protein Based On It'S Asa
... How can we characterize a residue in a protein as a buried, exposed or intermediate based on it's accessible surface area(ASA) ? I came across a paper in which they are taking the ratio between the residue's ASA at a particular position to the maximum ASA observed for that residue in the whole pro ...
protein structure written 10.6 years ago by Suk2111.0k • updated 10.6 years ago by Ryan40
0
votes
3
answers
1.6k
views
3
answers
Comment: C: State Of Computational Genomics
... Thanks for fixing the typo , was working on something else while posting this hence overlooked it. ...
written 10.6 years ago by Suk2111.0k
13
votes
3
answers
1.6k
views
3
answers
State Of Computational Genomics
... The other day on facebook, I posted this link and some of my friend started discussing about this article. It's "Watson Meets Moore" as Ion Torrent founder Jonatha Rothberg introduces post-light semiconductor sequencing. few comments from my friends Krishna : "I dont understand this rat race fo ...
genomics sequencing written 10.6 years ago by Suk2111.0k • updated 10.6 years ago by Mndoci1.2k
0
votes
6
answers
6.2k
views
6
answers
Comment: C: Pfam Based Functional Annotaion
... Hey Nicojo , Thanks for your reply. I am trying to find out what percentage of peptides in my library share a same biological process or have same molecular function .These peptides have length between 17-22 residues and Pfam was giving the annotation for a test run which I carried out a few weeks ...
written 10.6 years ago by Suk2111.0k
25
votes
6
answers
6.2k
views
11 follow
6
answers
Pfam Based Functional Annotaion
... I think in one of the earlier thread, Istvan has already asked about the reliability of GO annotation. I was wondering, if any of you have any experience with the functional annotation based upon the Pfam database. I am looking forward to functionally annotate a large set of peptide library and the ...
annotation protein written 10.6 years ago by Suk2111.0k • updated 2.9 years ago by Biostar ♦♦ 20
19
votes
25
answers
71k
views
25
answers
Answer: A: Which Are The Best Programming Languages For A Bioinformatician?
... I think the emphasis should be more on the way we optimize our program rather than language which we use. I personally use languages based on the kind of problem I am answering. This was an interesting paper which I came across some time back although some of the information mentioned in here might ...
written 10.6 years ago by Suk2111.0k • updated 8.1 years ago by Istvan Albert ♦♦ 84k
13
votes
38
answers
17k
views
38
answers
Answer: A: Your Favorite Bioinformatics Blogs (March 2010)
... A friend of mine is a very active blogger in bioinformatics. This is his blog site Fisheye Perspective He has also complied a list of bioinformatics and chemo informatics blogs which are very popular. some of you might be interested in it. 30+ Blogs about Bioinformatics and Chemoinformatics Progr ...
written 10.6 years ago by Suk2111.0k
6
votes
9
answers
3.6k
views
9
answers
Answer: A: What Is The Best Way To Share Scripts Between Members Of A Lab?
... This might be useful . A Quick Guide to Organizing Computational Biology Projects ...
written 10.6 years ago by Suk2111.0k
10
votes
11
answers
5.4k
views
11
answers
Answer: A: Where Can I Get The Secondary Structure Of A Protein?
... If you have the PDB file then you can use the standard tool called DSSP , it is supposed to be the gold standard for obtaining secondary structure. In case you just have sequence then I personally prefer PSIPRED , it takes evolutionary information into account to predict the secondary structure . Ac ...
written 10.6 years ago by Suk2111.0k
2
votes
9
answers
18k
views
9
answers
Answer: A: Finding Common Motifs In Sequences
... ACGGGCCCGACGATGCGTCGTA ACGTACGTCGAACCGTCGTCGT ACGTGCGTCGAAACGTCAGTCG ACGGGTTCGATCGTCGTCGTCG may be in Python I will break down the first sequence of required motif length into a sliding window and will search for those list of motifs in the rest of sequences using regular expression ...
written 11.0 years ago by Suk2111.0k • updated 13 months ago by RamRS30k

Latest awards to Suk211

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1756 users visited in the last hour