User: Ashi

gravatar for Ashi
Ashi0
Reputation:
0
Status:
New User
Last seen:
2 days, 13 hours ago
Joined:
1 week, 5 days ago
Email:
o***********@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by Ashi

<prev • 7 results • page 1 of 1 • next >
0
votes
1
answer
71
views
1
answers
Comment: C: How to see set of short reads mapped to a particular long read
... Thank you so much @genomax. I added the $10 also to see the read which has been mapped. ...
written 4 days ago by Ashi0
1
vote
1
answer
71
views
1
answer
How to see set of short reads mapped to a particular long read
... Hi, I am very new to NGS analysis. I have used BWA for mapping. My reference genome is a set of simulated long reads of E.Coli (I have used Badreads tool for this) and I have mapped short reads to this. Now I want to know for each long read which short reads have been mapped to it. My short reads ...
bioinformatics shortreads mapping longreads bwa written 5 days ago by Ashi0 • updated 5 days ago by genomax85k
0
votes
1
answer
82
views
1
answers
Comment: C: How to find mapped regions in the reference genome
... Yes thank you. That works. :) ...
written 12 days ago by Ashi0
0
votes
0
answers
45
views
0
answers
Comment: C: Renaming the reads in the fasta file
... I apologize for the inconvenience. Thank you for sharing the link. ...
written 12 days ago by Ashi0
0
votes
0
answers
45
views
0
answers
(Closed) Renaming the reads in the fasta file
... Hi I want to rename the reads in my fasta file. How can I do that? For example my long reads file has reads like: >8b9feef6-0991-f222-50a9-b14dbe470ab0 NC_000913.3,-strand,4290650-4324415 length=32583 error-free_length=33930 read_identity=84.85% CGTTCAGTACGTATTGCTAAACGGCGGAGAACCAGTCGAA ...
fasta bioinformatics ngs longreads written 12 days ago by Ashi0 • updated 12 days ago by RamRS27k
0
votes
1
answer
82
views
1
answers
Comment: C: How to find mapped regions in the reference genome
... Hi @genomax thank you for the help. Using the samtools and awk mentioned in the link that you gave me I got an output like this: Average = 1.08026 What I want is the coverage for each long read that I gave as the reference for mapping in the BWA. Is there a way to get that? ...
written 12 days ago by Ashi0
0
votes
1
answer
82
views
1
answer
How to find mapped regions in the reference genome
... Hi, I am very new to NGS analysis. I have used BWA for mapping. My reference genome is a set of simulated long reads of E.Coli (I have used Badreads tool for this) and I have mapped short reads to this. Now I want to know for each long read which portions have been mapped. My ultimate goal is to ...
genome alignment longreads bwa sequencing written 12 days ago by Ashi0

Latest awards to Ashi

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1888 users visited in the last hour