User: renyulb

gravatar for renyulb
renyulb0
Reputation:
0
Status:
New User
Last seen:
1 week, 4 days ago
Joined:
1 week, 5 days ago
Email:
r******@umich.edu

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by renyulb

<prev • 1 results • page 1 of 1 • next >
0
votes
0
answers
63
views
0
answers
Extract codon between two flanking sequences from FASTA
... Hi all, given two 10bp flanking sequences, I would like to extract the codon between them across all samples in a FASTA file. For example: Flank1: CAGGCATGCC Flank2: TCATCGCTGG FASTA >sample1 GCGCACCATGGTCAGGCATGCCTCCTCATCGCTGGGCACAGCCCAGAGGGT >sample2 GGCAG ...
sequencing genome written 12 days ago by renyulb0

Latest awards to renyulb

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1698 users visited in the last hour